Incidental Mutation 'R1368:Slc25a11'
ID155889
Institutional Source Beutler Lab
Gene Symbol Slc25a11
Ensembl Gene ENSMUSG00000014606
Gene Namesolute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Synonyms2310022P18Rik, 2oxoc
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70644196-70647479 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to A at 70645526 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000037534] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638] [ENSMUST00000141695] [ENSMUST00000152160]
Predicted Effect probably null
Transcript: ENSMUST00000014750
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037534
SMART Domains Protein: ENSMUSP00000036472
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PA 53 150 1.4e-14 PFAM
transmembrane domain 172 194 N/A INTRINSIC
RING 230 271 2.65e-9 SMART
low complexity region 278 303 N/A INTRINSIC
low complexity region 332 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055184
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108551
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably benign
Transcript: ENSMUST00000136383
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139638
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141537
Predicted Effect probably benign
Transcript: ENSMUST00000141695
SMART Domains Protein: ENSMUSP00000121511
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151034
Predicted Effect probably benign
Transcript: ENSMUST00000152160
SMART Domains Protein: ENSMUSP00000115057
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The oxoglutarate/malate carrier transports 2-oxoglutarate across the inner membranes of mitochondria in an electroneutral exchange for malate or other dicarboxylic acids (summary by Iacobazzi et al., 1992 [PubMed 1457818]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Slc25a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Slc25a11 APN 11 70645207 missense probably benign 0.09
IGL03348:Slc25a11 APN 11 70645344 unclassified probably benign
R0448:Slc25a11 UTSW 11 70645579 missense probably benign 0.43
R1505:Slc25a11 UTSW 11 70646824 missense probably benign
R1781:Slc25a11 UTSW 11 70644825 missense probably benign 0.44
R1970:Slc25a11 UTSW 11 70646173 missense probably benign 0.25
R2508:Slc25a11 UTSW 11 70645832 missense possibly damaging 0.95
R4397:Slc25a11 UTSW 11 70644851 missense probably benign 0.01
R4747:Slc25a11 UTSW 11 70645956 missense possibly damaging 0.95
R5177:Slc25a11 UTSW 11 70645817 missense probably damaging 1.00
R5243:Slc25a11 UTSW 11 70646098 missense probably damaging 1.00
R5296:Slc25a11 UTSW 11 70646185 missense probably damaging 0.97
R5510:Slc25a11 UTSW 11 70645535 missense probably damaging 1.00
R5662:Slc25a11 UTSW 11 70645419 nonsense probably null
R5771:Slc25a11 UTSW 11 70646190 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTGGTAGTCAACTCTCAGGTAGC -3'
(R):5'- CATCAGGGCACTTACCTATTCAGGC -3'

Sequencing Primer
(F):5'- TAGTCAACTCTCAGGTAGCTCAGG -3'
(R):5'- CACTTACCTATTCAGGCTTCCC -3'
Posted On2014-02-11