Incidental Mutation 'R1368:Eif2b2'
ID155893
Institutional Source Beutler Lab
Gene Symbol Eif2b2
Ensembl Gene ENSMUSG00000004788
Gene Nameeukaryotic translation initiation factor 2B, subunit 2 beta
SynonymsEIF2B, EIF-2Bbeta
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85219481-85226628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85223456 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 257 (A257T)
Ref Sequence ENSEMBL: ENSMUSP00000004910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004910] [ENSMUST00000136495] [ENSMUST00000140900]
Predicted Effect probably damaging
Transcript: ENSMUST00000004910
AA Change: A257T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004910
Gene: ENSMUSG00000004788
AA Change: A257T

DomainStartEndE-ValueType
Pfam:IF-2B 27 333 3.2e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130760
Predicted Effect probably benign
Transcript: ENSMUST00000136495
SMART Domains Protein: ENSMUSP00000122720
Gene: ENSMUSG00000004788

DomainStartEndE-ValueType
Pfam:IF-2B 27 232 2e-51 PFAM
Pfam:IF-2B 229 287 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140900
SMART Domains Protein: ENSMUSP00000122954
Gene: ENSMUSG00000004788

DomainStartEndE-ValueType
Pfam:IF-2B 27 228 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151925
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of eukaryotic initiation factor-2B (EIF2B). EIF2B is involved in protein synthesis and exchanges GDP and GTP for its activation and deactivation. Mutations in the human gene are associated with ovarioleukodystrophy and leukoencephalopathy with vanishing white matter. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Eif2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Eif2b2 APN 12 85219834 missense probably benign 0.00
IGL03156:Eif2b2 APN 12 85219721 missense probably damaging 1.00
IGL03238:Eif2b2 APN 12 85223399 missense probably benign 0.01
R0471:Eif2b2 UTSW 12 85220183 missense probably benign
R0785:Eif2b2 UTSW 12 85221561 missense probably damaging 1.00
R1442:Eif2b2 UTSW 12 85219586 missense probably benign 0.00
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R5931:Eif2b2 UTSW 12 85222787 missense probably damaging 1.00
R6954:Eif2b2 UTSW 12 85226043 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCAGCTTCCCATGCCACAAC -3'
(R):5'- GGTGGATCAACTCCACTGAGCAAG -3'

Sequencing Primer
(F):5'- AGAACTTTCCAGTCCTGAGC -3'
(R):5'- TCCACTGAGCAAGCAACAG -3'
Posted On2014-02-11