Incidental Mutation 'R1368:Ptgdr'
ID155897
Institutional Source Beutler Lab
Gene Symbol Ptgdr
Ensembl Gene ENSMUSG00000071489
Gene Nameprostaglandin D receptor
SynonymsDP
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location44851235-44859375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44853342 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 320 (I320F)
Ref Sequence ENSEMBL: ENSMUSP00000093653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095959]
Predicted Effect probably damaging
Transcript: ENSMUST00000095959
AA Change: I320F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093653
Gene: ENSMUSG00000071489
AA Change: I320F

DomainStartEndE-ValueType
low complexity region 22 46 N/A INTRINSIC
Pfam:7tm_1 54 319 1.1e-18 PFAM
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein is reported to be a receptor for prostaglandin D2, which is a mediator of allergic inflammation and allergic airway inflammation in asthma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduced inflammatory response to airborn allergens and reduced susceptibility to passive cutaneous anaphylaxis induced by IgE antigen challenge due to impaired mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Ptgdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Ptgdr APN 14 44858614 missense probably damaging 1.00
R1036:Ptgdr UTSW 14 44859115 missense probably damaging 0.98
R1649:Ptgdr UTSW 14 44858502 missense probably benign
R1785:Ptgdr UTSW 14 44858579 nonsense probably null
R1786:Ptgdr UTSW 14 44858579 nonsense probably null
R1921:Ptgdr UTSW 14 44853281 missense probably benign 0.00
R2312:Ptgdr UTSW 14 44859162 missense probably damaging 1.00
R4867:Ptgdr UTSW 14 44858796 missense probably damaging 1.00
R5198:Ptgdr UTSW 14 44858843 missense probably damaging 1.00
R6917:Ptgdr UTSW 14 44858610 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTTTCCAAGCACGGCTCTTTGAATG -3'
(R):5'- CTGAGAATGCAGAACAGCCCTGAG -3'

Sequencing Primer
(F):5'- AATGTGTGCTGTATTTTCAGCTTATC -3'
(R):5'- TCAGCCATAGGGTGAGAATTCC -3'
Posted On2014-02-11