Incidental Mutation 'R1368:Ppp3cc'
ID155900
Institutional Source Beutler Lab
Gene Symbol Ppp3cc
Ensembl Gene ENSMUSG00000022092
Gene Nameprotein phosphatase 3, catalytic subunit, gamma isoform
SynonymsCalnc, PP2BA gamma
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70217865-70289471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70245862 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 254 (Y254C)
Ref Sequence ENSEMBL: ENSMUSP00000153725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078434] [ENSMUST00000228911]
Predicted Effect probably damaging
Transcript: ENSMUST00000078434
AA Change: Y254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077532
Gene: ENSMUSG00000022092
AA Change: Y254C

DomainStartEndE-ValueType
PP2Ac 52 343 4e-151 SMART
low complexity region 413 433 N/A INTRINSIC
low complexity region 492 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228265
Predicted Effect probably damaging
Transcript: ENSMUST00000228911
AA Change: Y254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Ppp3cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Ppp3cc APN 14 70218252 missense probably damaging 0.99
IGL02182:Ppp3cc APN 14 70225024 missense probably benign 0.21
IGL02272:Ppp3cc APN 14 70236489 missense probably damaging 1.00
IGL03207:Ppp3cc APN 14 70247582 missense probably damaging 1.00
IGL03394:Ppp3cc APN 14 70225028 nonsense probably null
tomap UTSW 14 70240948 missense probably damaging 1.00
R0111:Ppp3cc UTSW 14 70256359 critical splice donor site probably null
R0625:Ppp3cc UTSW 14 70225027 missense probably damaging 0.99
R1484:Ppp3cc UTSW 14 70240948 missense probably damaging 1.00
R4757:Ppp3cc UTSW 14 70218186 missense possibly damaging 0.94
R6198:Ppp3cc UTSW 14 70247611 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTCATAATACCAGGTGTGGTGGCAAG -3'
(R):5'- AATCTGCTGCTTCCAAAAGCCTTTTAC -3'

Sequencing Primer
(F):5'- gacctaagttcccagcacc -3'
(R):5'- TCCAAAAGCCTTTTACTTTCCTG -3'
Posted On2014-02-11