Incidental Mutation 'R1368:Cct8'
ID155903
Institutional Source Beutler Lab
Gene Symbol Cct8
Ensembl Gene ENSMUSG00000025613
Gene Namechaperonin containing Tcp1, subunit 8 (theta)
SynonymsCctq, Tcpq
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87483326-87495873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87491312 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 124 (S124L)
Ref Sequence ENSEMBL: ENSMUSP00000135651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000175977] [ENSMUST00000176041] [ENSMUST00000176750] [ENSMUST00000177376]
Predicted Effect probably damaging
Transcript: ENSMUST00000026704
AA Change: S124L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613
AA Change: S124L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 529 6.7e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175717
Predicted Effect probably benign
Transcript: ENSMUST00000175750
SMART Domains Protein: ENSMUSP00000134920
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 238 1.2e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175977
AA Change: S124L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613
AA Change: S124L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 132 4.5e-32 PFAM
Pfam:Cpn60_TCP1 120 470 1.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176041
AA Change: S70L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135377
Gene: ENSMUSG00000025613
AA Change: S70L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 158 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176589
Predicted Effect probably benign
Transcript: ENSMUST00000176750
AA Change: S70L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135830
Gene: ENSMUSG00000025613
AA Change: S70L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 132 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177301
Predicted Effect probably benign
Transcript: ENSMUST00000177376
SMART Domains Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
PDB:4B2T|Q 1 51 1e-29 PDB
SCOP:d1oela1 26 51 8e-4 SMART
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the theta subunit of the CCT chaperonin, which is abundant in the eukaryotic cytosol and may be involved in the transport and assembly of newly synthesized proteins. Alternative splicing results in multiple transcript variants of this gene. A pseudogene related to this gene is located on chromosome 1. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Cct8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Cct8 APN 16 87490476 splice site probably benign
IGL02975:Cct8 APN 16 87486230 splice site probably benign
IGL03015:Cct8 APN 16 87486665 splice site probably benign
IGL03191:Cct8 APN 16 87486310 missense probably damaging 1.00
R0479:Cct8 UTSW 16 87487706 missense probably damaging 1.00
R0972:Cct8 UTSW 16 87486620 missense possibly damaging 0.94
R1544:Cct8 UTSW 16 87491454 splice site probably benign
R1548:Cct8 UTSW 16 87485584 missense probably damaging 0.99
R1823:Cct8 UTSW 16 87490554 nonsense probably null
R2303:Cct8 UTSW 16 87490332 unclassified probably null
R3076:Cct8 UTSW 16 87488877 missense possibly damaging 0.84
R3078:Cct8 UTSW 16 87488877 missense possibly damaging 0.84
R4094:Cct8 UTSW 16 87487628 missense possibly damaging 0.94
R4713:Cct8 UTSW 16 87487688 nonsense probably null
R5031:Cct8 UTSW 16 87487538 missense probably damaging 0.99
R5687:Cct8 UTSW 16 87488821 missense probably benign 0.00
R6325:Cct8 UTSW 16 87495727 critical splice donor site probably null
R6391:Cct8 UTSW 16 87487678 missense probably benign 0.00
R6395:Cct8 UTSW 16 87486476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTACACCGTAAGCCCATGTGACTG -3'
(R):5'- GCCTGCCATCAAGGAACTTACTGAC -3'

Sequencing Primer
(F):5'- AGCAGGTTCCAGTGATACTCC -3'
(R):5'- ATGTTGCTCCACGTACACG -3'
Posted On2014-02-11