Incidental Mutation 'R1370:Kalrn'
ID155973
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 039434-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R1370 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33975584 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1274 (I1274F)
Ref Sequence ENSEMBL: ENSMUSP00000110624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: I2943F

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: I2943F

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114973
AA Change: I1274F

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: I1274F

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132002
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adgra3 T C 5: 49,960,787 I1140V possibly damaging Het
Adrb3 A T 8: 27,227,770 probably null Het
Afap1 A G 5: 35,935,600 D16G unknown Het
AI593442 T C 9: 52,678,008 K90E probably damaging Het
Aicda A T 6: 122,561,185 N101Y probably benign Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
Bin1 A G 18: 32,429,703 I416V probably benign Het
Bptf A T 11: 107,047,094 S2724T probably damaging Het
Brf1 A T 12: 112,961,108 probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cdan1 A G 2: 120,719,139 probably null Het
Chaf1a A T 17: 56,064,032 H639L probably benign Het
Chd1 G A 17: 17,387,480 G430D probably benign Het
Clca3a2 T C 3: 144,813,863 probably benign Het
Clptm1 A G 7: 19,633,872 V605A possibly damaging Het
Cmpk2 A G 12: 26,471,452 D241G probably damaging Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dennd4c T A 4: 86,811,510 I783N probably damaging Het
Dock10 A G 1: 80,540,343 S1305P probably damaging Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Gbp8 C T 5: 105,016,576 A394T possibly damaging Het
Gm13023 T A 4: 143,795,304 L497I possibly damaging Het
H1fx A G 6: 87,981,151 I69T probably damaging Het
Herc2 T A 7: 56,168,873 C2771S probably benign Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Klk11 A G 7: 43,776,907 I22V probably benign Het
Krt6b T C 15: 101,677,552 D362G probably damaging Het
Lce1e A G 3: 92,707,843 S66P unknown Het
Letm1 A T 5: 33,778,682 probably null Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Mrpl12 A G 11: 120,485,301 S46G probably benign Het
Narfl A G 17: 25,776,988 E62G probably benign Het
Ndrg3 T C 2: 156,938,650 E198G probably damaging Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Pcdh20 A G 14: 88,468,301 I521T probably benign Het
Pdzph1 T C 17: 58,974,087 D400G possibly damaging Het
Per2 A T 1: 91,445,557 S170T possibly damaging Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rerg A T 6: 137,057,801 probably benign Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Sept2 G T 1: 93,499,106 V146L probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Sh3bp4 A T 1: 89,143,772 Y114F probably benign Het
Slc44a5 C A 3: 154,243,159 T188K probably benign Het
Slco6d1 A C 1: 98,423,094 I100L probably benign Het
Slfn4 G T 11: 83,188,806 D441Y probably damaging Het
Smg1 T C 7: 118,159,752 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Stard9 T C 2: 120,697,477 V1405A probably benign Het
Syt1 A G 10: 108,690,922 L42P probably damaging Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tbcel A T 9: 42,450,062 D63E probably damaging Het
Tdrd3 A T 14: 87,458,054 probably benign Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Tsc22d1 A G 14: 76,437,664 probably benign Het
Tsga10 G T 1: 37,835,453 T117K probably damaging Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Ttn G T 2: 76,847,151 probably benign Het
Wasf3 T C 5: 146,470,208 probably benign Het
Zbtb37 C T 1: 161,032,022 E238K probably benign Het
Zfp354c A G 11: 50,815,840 I136T probably benign Het
Zfp384 G A 6: 125,036,453 A479T probably benign Het
Zfp646 T A 7: 127,879,864 N404K probably damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTCCAGAGAACCACATGGAG -3'
(R):5'- CATATCCACCATCTGCTGGGGAAC -3'

Sequencing Primer
(F):5'- CCACATGGAGTGAAATGATGATCAG -3'
(R):5'- TGCCAGGGATTTCATCAACG -3'
Posted On2014-02-11