Incidental Mutation 'R1370:Narfl'
ID155980
Institutional Source Beutler Lab
Gene Symbol Narfl
Ensembl Gene ENSMUSG00000002280
Gene Namenuclear prelamin A recognition factor-like
Synonyms
MMRRC Submission 039434-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1370 (G1)
Quality Score153
Status Validated
Chromosome17
Chromosomal Location25773776-25783332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25776988 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 62 (E62G)
Ref Sequence ENSEMBL: ENSMUSP00000117136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002350] [ENSMUST00000131458] [ENSMUST00000134108] [ENSMUST00000140738]
Predicted Effect probably benign
Transcript: ENSMUST00000002350
AA Change: E62G

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002350
Gene: ENSMUSG00000002280
AA Change: E62G

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 406 8.5e-95 PFAM
Fe_hyd_SSU 410 466 9.56e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130861
Predicted Effect unknown
Transcript: ENSMUST00000131458
AA Change: R68G
SMART Domains Protein: ENSMUSP00000120281
Gene: ENSMUSG00000002280
AA Change: R68G

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134108
AA Change: E62G

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117136
Gene: ENSMUSG00000002280
AA Change: E62G

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 422 4e-85 PFAM
Fe_hyd_SSU 426 482 9.56e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140738
SMART Domains Protein: ENSMUSP00000116841
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183975
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted knock-out die before E10.5. Mice heterozygous for a targeted allele exhibit partial lethality between E10.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adgra3 T C 5: 49,960,787 I1140V possibly damaging Het
Adrb3 A T 8: 27,227,770 probably null Het
Afap1 A G 5: 35,935,600 D16G unknown Het
AI593442 T C 9: 52,678,008 K90E probably damaging Het
Aicda A T 6: 122,561,185 N101Y probably benign Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
Bin1 A G 18: 32,429,703 I416V probably benign Het
Bptf A T 11: 107,047,094 S2724T probably damaging Het
Brf1 A T 12: 112,961,108 probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cdan1 A G 2: 120,719,139 probably null Het
Chaf1a A T 17: 56,064,032 H639L probably benign Het
Chd1 G A 17: 17,387,480 G430D probably benign Het
Clca3a2 T C 3: 144,813,863 probably benign Het
Clptm1 A G 7: 19,633,872 V605A possibly damaging Het
Cmpk2 A G 12: 26,471,452 D241G probably damaging Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dennd4c T A 4: 86,811,510 I783N probably damaging Het
Dock10 A G 1: 80,540,343 S1305P probably damaging Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Gbp8 C T 5: 105,016,576 A394T possibly damaging Het
Gm13023 T A 4: 143,795,304 L497I possibly damaging Het
H1fx A G 6: 87,981,151 I69T probably damaging Het
Herc2 T A 7: 56,168,873 C2771S probably benign Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Klk11 A G 7: 43,776,907 I22V probably benign Het
Krt6b T C 15: 101,677,552 D362G probably damaging Het
Lce1e A G 3: 92,707,843 S66P unknown Het
Letm1 A T 5: 33,778,682 probably null Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Mrpl12 A G 11: 120,485,301 S46G probably benign Het
Ndrg3 T C 2: 156,938,650 E198G probably damaging Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Pcdh20 A G 14: 88,468,301 I521T probably benign Het
Pdzph1 T C 17: 58,974,087 D400G possibly damaging Het
Per2 A T 1: 91,445,557 S170T possibly damaging Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rerg A T 6: 137,057,801 probably benign Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Sept2 G T 1: 93,499,106 V146L probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Sh3bp4 A T 1: 89,143,772 Y114F probably benign Het
Slc44a5 C A 3: 154,243,159 T188K probably benign Het
Slco6d1 A C 1: 98,423,094 I100L probably benign Het
Slfn4 G T 11: 83,188,806 D441Y probably damaging Het
Smg1 T C 7: 118,159,752 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Stard9 T C 2: 120,697,477 V1405A probably benign Het
Syt1 A G 10: 108,690,922 L42P probably damaging Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tbcel A T 9: 42,450,062 D63E probably damaging Het
Tdrd3 A T 14: 87,458,054 probably benign Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Tsc22d1 A G 14: 76,437,664 probably benign Het
Tsga10 G T 1: 37,835,453 T117K probably damaging Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Ttn G T 2: 76,847,151 probably benign Het
Wasf3 T C 5: 146,470,208 probably benign Het
Zbtb37 C T 1: 161,032,022 E238K probably benign Het
Zfp354c A G 11: 50,815,840 I136T probably benign Het
Zfp384 G A 6: 125,036,453 A479T probably benign Het
Zfp646 T A 7: 127,879,864 N404K probably damaging Het
Other mutations in Narfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Narfl APN 17 25780320 missense possibly damaging 0.83
IGL02266:Narfl APN 17 25780326 missense possibly damaging 0.91
IGL02537:Narfl APN 17 25778942 unclassified probably benign
IGL02926:Narfl APN 17 25782154 missense probably benign
R0097:Narfl UTSW 17 25777002 missense possibly damaging 0.94
R0097:Narfl UTSW 17 25777002 missense possibly damaging 0.94
R0723:Narfl UTSW 17 25781821 missense probably damaging 1.00
R1219:Narfl UTSW 17 25775101 missense probably damaging 1.00
R4737:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4739:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4740:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4747:Narfl UTSW 17 25780353 missense probably benign 0.04
R4826:Narfl UTSW 17 25780332 missense probably damaging 1.00
R5382:Narfl UTSW 17 25776920 unclassified probably benign
R5789:Narfl UTSW 17 25781203 missense probably benign
R7275:Narfl UTSW 17 25775134 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGAGCCCAGTCTGCTCTCATTGC -3'
(R):5'- GTCAGACATCACTAACACGGGTCAC -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- CTAACACGGGTCACTGGGAG -3'
Posted On2014-02-11