Incidental Mutation 'R1365:Nf1'
ID156006
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 039430-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1365 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 79547885 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]
Predicted Effect probably null
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137997
SMART Domains Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
low complexity region 604 614 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146699
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 G A 13: 98,075,124 T117M probably damaging Het
Asb15 T C 6: 24,567,270 I530T possibly damaging Het
Brca1 T C 11: 101,501,996 N1673S probably benign Het
Cd48 A T 1: 171,699,561 Q185L probably damaging Het
Cog2 A T 8: 124,540,974 K343I probably damaging Het
Dars2 G A 1: 161,044,994 Q546* probably null Het
Dst A G 1: 34,188,194 K1623E probably benign Het
Epn1 G A 7: 5,093,370 R221Q probably benign Het
Gtf2b T C 3: 142,771,466 I33T probably damaging Het
Hsf4 G T 8: 105,271,094 R156L probably damaging Het
Itch A G 2: 155,213,031 N752D probably benign Het
Kif28 G A 1: 179,739,987 Q73* probably null Het
Mamdc4 T C 2: 25,566,024 Y790C probably damaging Het
Med1 T C 11: 98,155,995 probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Oxct2b G A 4: 123,117,369 V361I probably benign Het
Pid1 T C 1: 84,038,141 M168V probably damaging Het
Plk1 A G 7: 122,168,629 D419G probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sem1 T C 6: 6,560,501 D26G possibly damaging Het
Sin3a C T 9: 57,125,203 R1141* probably null Het
Slf1 C T 13: 77,126,371 A68T probably damaging Het
Trmo A G 4: 46,380,278 S364P probably damaging Het
Uchl3 A G 14: 101,654,092 E10G probably damaging Het
Usp14 C T 18: 10,000,490 probably null Het
Vmn1r203 T A 13: 22,524,586 M179K probably benign Het
Vps13a A G 19: 16,619,446 Y3103H probably damaging Het
Zfp804a T C 2: 82,257,246 L473P probably benign Het
Zfp979 A T 4: 147,613,224 Y343N probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTTTGGCATTAGCAAAGTCAAGTCG -3'
(R):5'- AGCCACTTGCATGTTGGAATATCTCTC -3'

Sequencing Primer
(F):5'- TCGGCTGCTGTCATTGC -3'
(R):5'- ccagcaaaacattcagatacataaag -3'
Posted On2014-02-11