Incidental Mutation 'R1367:Slpi'
ID156061
Institutional Source Beutler Lab
Gene Symbol Slpi
Ensembl Gene ENSMUSG00000017002
Gene Namesecretory leukocyte peptidase inhibitor
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1367 (G1)
Quality Score103
Status Validated
Chromosome2
Chromosomal Location164354070-164389095 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 164354867 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109367] [ENSMUST00000165980] [ENSMUST00000167427]
Predicted Effect probably benign
Transcript: ENSMUST00000109367
SMART Domains Protein: ENSMUSP00000104992
Gene: ENSMUSG00000017002

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WAP 32 77 7.06e-5 SMART
WAP 86 131 1.11e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165980
SMART Domains Protein: ENSMUSP00000128025
Gene: ENSMUSG00000017002

DomainStartEndE-ValueType
WAP 8 53 7.06e-5 SMART
WAP 62 107 1.11e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185076
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice been independently reported to exhibit increased susceptibility to LPS-induced endotoxin shock with elevated production of IL-6, impaired cutaneous wound healing with increased inflammation and elastase activity, and high susceptibility to pulmonary mycobacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Slpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Slpi APN 2 164355447 unclassified probably benign
IGL03356:Slpi APN 2 164356209 missense probably benign 0.00
R1459:Slpi UTSW 2 164354917 missense probably damaging 1.00
R1991:Slpi UTSW 2 164355543 missense probably damaging 1.00
R2103:Slpi UTSW 2 164355543 missense probably damaging 1.00
R3801:Slpi UTSW 2 164356238 missense probably damaging 1.00
R6473:Slpi UTSW 2 164354926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACTCTGAGAGCCATTCACCC -3'
(R):5'- GTGTTGCCTGAGCCCTAAGACATC -3'

Sequencing Primer
(F):5'- CTTACCCTGACAGGCTGC -3'
(R):5'- TAAGACATCGGCCCTGTGAATC -3'
Posted On2014-02-11