Incidental Mutation 'R1367:Hectd3'
ID156065
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene NameHECT domain E3 ubiquitin protein ligase 3
Synonyms1700064K09Rik
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116995317-117005277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116997170 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 310 (V310L)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000050067] [ENSMUST00000130273]
Predicted Effect probably benign
Transcript: ENSMUST00000030446
SMART Domains Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 14 360 2.4e-135 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000050067
AA Change: V310L

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: V310L

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127635
Predicted Effect probably benign
Transcript: ENSMUST00000130273
SMART Domains Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 1 64 1.2e-18 PFAM
Pfam:URO-D 60 120 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155267
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGACAGATAGCAACGCAGATAC -3'
(R):5'- AAACTCCTTATAGTCCTGAGCCCTACC -3'

Sequencing Primer
(F):5'- AACACTGGGTACGGCTTAC -3'
(R):5'- GGACGGTCATGTCCTCTAATACAC -3'
Posted On2014-02-11