Incidental Mutation 'R1367:Pms2'
ID156070
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene NamePMS1 homolog2, mismatch repair system component
Synonymsmismatch repair, DNA mismatch repair
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143909964-143933968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143925913 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 613 (V613M)
Ref Sequence ENSEMBL: ENSMUSP00000119875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110707
Predicted Effect probably benign
Transcript: ENSMUST00000110709
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141942
Predicted Effect probably damaging
Transcript: ENSMUST00000148011
AA Change: V613M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: V613M

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164999
SMART Domains Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
DNA_mis_repair 1 70 4.47e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170083
Predicted Effect probably benign
Transcript: ENSMUST00000172367
SMART Domains Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

DomainStartEndE-ValueType
MutL_C 5 139 1.78e-1 SMART
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143923519 missense probably damaging 1.00
IGL02009:Pms2 APN 5 143925764 missense probably benign 0.42
IGL02801:Pms2 APN 5 143925835 missense probably benign 0.06
P0047:Pms2 UTSW 5 143919598 missense probably damaging 1.00
R1422:Pms2 UTSW 5 143913705 missense probably damaging 1.00
R1854:Pms2 UTSW 5 143925896 missense probably benign 0.08
R1997:Pms2 UTSW 5 143913700 missense probably damaging 1.00
R2248:Pms2 UTSW 5 143916506 missense probably damaging 1.00
R2873:Pms2 UTSW 5 143911914 splice site probably benign
R4072:Pms2 UTSW 5 143929001 missense probably damaging 0.99
R4082:Pms2 UTSW 5 143931019 missense probably damaging 1.00
R4358:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R5100:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5101:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5228:Pms2 UTSW 5 143923597 missense probably damaging 0.99
R5484:Pms2 UTSW 5 143928125 missense probably damaging 1.00
R6310:Pms2 UTSW 5 143923583 missense probably benign 0.06
R6331:Pms2 UTSW 5 143914633 missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143928968 missense probably damaging 0.99
R6718:Pms2 UTSW 5 143923489 missense probably damaging 0.98
R6747:Pms2 UTSW 5 143925419 missense probably benign 0.02
X0064:Pms2 UTSW 5 143916466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAAGCTCTACCTCTAGCTCGTC -3'
(R):5'- CATCCGCACAGTGCAAGAAATGAAG -3'

Sequencing Primer
(F):5'- TCGTCTGTCACCCACAAATG -3'
(R):5'- CTAGAGCAGCCGACACTG -3'
Posted On2014-02-11