Incidental Mutation 'R1367:Pxk'
ID156089
Institutional Source Beutler Lab
Gene Symbol Pxk
Ensembl Gene ENSMUSG00000033885
Gene NamePX domain containing serine/threonine kinase
SynonymsMONaKA, D14Ertd813e, C230080L11Rik
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R1367 (G1)
Quality Score190
Status Validated
Chromosome14
Chromosomal Location8098211-8165117 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 8150915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036682] [ENSMUST00000112689] [ENSMUST00000225653]
Predicted Effect probably null
Transcript: ENSMUST00000036682
SMART Domains Protein: ENSMUSP00000035265
Gene: ENSMUSG00000033885

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase 183 441 1.1e-9 PFAM
Pfam:Pkinase_Tyr 185 309 2.5e-7 PFAM
low complexity region 483 536 N/A INTRINSIC
Pfam:WH2 549 577 1.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112689
SMART Domains Protein: ENSMUSP00000108309
Gene: ENSMUSG00000033885

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase_Tyr 185 309 3e-7 PFAM
Pfam:Pkinase 185 441 1.4e-10 PFAM
low complexity region 483 509 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000225653
Meta Mutation Damage Score 0.6252 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phox (PX) domain-containing protein which may be involved in synaptic transmission and the ligand-induced internalization and degradation of epidermal growth factors. Variations in this gene may be associated with susceptibility to systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Pxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pxk APN 14 8130754 missense probably damaging 1.00
IGL01865:Pxk APN 14 8136923 missense possibly damaging 0.94
IGL03171:Pxk APN 14 8151014 splice site probably benign
PIT4131001:Pxk UTSW 14 8152130 missense probably benign 0.01
R0799:Pxk UTSW 14 8148123 missense probably benign 0.02
R1546:Pxk UTSW 14 8164091 missense probably damaging 1.00
R1800:Pxk UTSW 14 8151507 nonsense probably null
R1827:Pxk UTSW 14 8151507 nonsense probably null
R1828:Pxk UTSW 14 8151507 nonsense probably null
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1892:Pxk UTSW 14 8151507 nonsense probably null
R1893:Pxk UTSW 14 8151507 nonsense probably null
R3766:Pxk UTSW 14 8136863 splice site probably benign
R4807:Pxk UTSW 14 8144133 missense probably damaging 1.00
R4816:Pxk UTSW 14 8136893 missense probably damaging 1.00
R4833:Pxk UTSW 14 8130653 missense probably damaging 1.00
R4974:Pxk UTSW 14 8140734 missense probably damaging 1.00
R5400:Pxk UTSW 14 8136911 missense probably benign 0.45
R6075:Pxk UTSW 14 8150964 missense probably benign 0.05
R6144:Pxk UTSW 14 8138011 missense probably damaging 0.99
R6211:Pxk UTSW 14 8163952 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAATAAGAAGGAAGGGCCTCCCTG -3'
(R):5'- TGTGGGTGAACGTCCAAAGTCAATC -3'

Sequencing Primer
(F):5'- tgtagtatttgacttttaccaatgcc -3'
(R):5'- CAATCACTGTGAATGGGTCACTG -3'
Posted On2014-02-11