Incidental Mutation 'R1367:Acvr1b'
ID156092
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Nameactivin A receptor, type 1B
SynonymsActR-IB, ActRIB, Alk4, SKR2, Acvrlk4
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101174067-101213684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101193938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 33 (L33P)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000544
AA Change: L33P

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: L33P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199512
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
IGL02984:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
R1498:Acvr1b UTSW 15 101194010 missense probably benign
R1591:Acvr1b UTSW 15 101194024 missense probably benign
R1757:Acvr1b UTSW 15 101198822 missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101194025 missense probably benign 0.01
R2223:Acvr1b UTSW 15 101203043 missense probably benign 0.10
R2249:Acvr1b UTSW 15 101203094 missense probably null 1.00
R4674:Acvr1b UTSW 15 101203058 missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101202986 missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101210770 missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101193976 missense probably damaging 1.00
R5397:Acvr1b UTSW 15 101198964 missense probably damaging 0.99
R5574:Acvr1b UTSW 15 101202077 missense probably benign 0.03
R5906:Acvr1b UTSW 15 101193891 intron probably benign
R6025:Acvr1b UTSW 15 101194975 missense probably benign 0.43
R6467:Acvr1b UTSW 15 101194841 missense possibly damaging 0.86
X0067:Acvr1b UTSW 15 101194022 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TAAGGTGCAGTAGTGCCAGCCAAG -3'
(R):5'- CGAAAGGACAAGATGCCCTTCCTC -3'

Sequencing Primer
(F):5'- AGCCAAGGCTGCCTTTCTG -3'
(R):5'- AGGTCAATCTTGTTGCAGAAGTC -3'
Posted On2014-02-11