Incidental Mutation 'R1367:Tkfc'
ID156099
Institutional Source Beutler Lab
Gene Symbol Tkfc
Ensembl Gene ENSMUSG00000034371
Gene Nametriokinase, FMN cyclase
SynonymsDak
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10592200-10604258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10593474 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 481 (S481P)
Ref Sequence ENSEMBL: ENSMUSP00000044556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037678] [ENSMUST00000168445]
Predicted Effect probably benign
Transcript: ENSMUST00000037678
AA Change: S481P

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371
AA Change: S481P

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168445
SMART Domains Protein: ENSMUSP00000130680
Gene: ENSMUSG00000034445

DomainStartEndE-ValueType
B561 46 175 1.47e-40 SMART
low complexity region 205 219 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Tkfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tkfc APN 19 10594528 missense probably benign 0.28
IGL01149:Tkfc APN 19 10600651 missense probably damaging 1.00
IGL02726:Tkfc APN 19 10596212 missense possibly damaging 0.67
IGL03069:Tkfc APN 19 10599154 missense probably benign
R1476:Tkfc UTSW 19 10595326 missense probably null 0.55
R2081:Tkfc UTSW 19 10597378 missense probably damaging 1.00
R2130:Tkfc UTSW 19 10596041 missense probably damaging 0.97
R2151:Tkfc UTSW 19 10599057 missense probably damaging 1.00
R2443:Tkfc UTSW 19 10594538 missense probably damaging 0.97
R3104:Tkfc UTSW 19 10596993 nonsense probably null
R3105:Tkfc UTSW 19 10596993 nonsense probably null
R3106:Tkfc UTSW 19 10596993 nonsense probably null
R5027:Tkfc UTSW 19 10592659 unclassified probably null
R5601:Tkfc UTSW 19 10594563 missense probably benign
R5637:Tkfc UTSW 19 10594533 missense probably benign 0.00
R5933:Tkfc UTSW 19 10597347 missense probably benign 0.17
R6792:Tkfc UTSW 19 10594524 missense probably benign
R6845:Tkfc UTSW 19 10599332 missense probably damaging 0.99
R6909:Tkfc UTSW 19 10596266 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAAAGGGGAACCTACCATTGTCCTG -3'
(R):5'- TGAAAGGCCGCCTGTCTCTACTTG -3'

Sequencing Primer
(F):5'- CTGTCTCCTGGTGCAGC -3'
(R):5'- TACTTGCAGCCATTCAGGG -3'
Posted On2014-02-11