Incidental Mutation 'R1329:Myrfl'
ID156123
Institutional Source Beutler Lab
Gene Symbol Myrfl
Ensembl Gene ENSMUSG00000034057
Gene Namemyelin regulatory factor-like
SynonymsLOC237558, Gm239
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location116776535-116896919 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 116777342 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048229]
Predicted Effect probably null
Transcript: ENSMUST00000048229
SMART Domains Protein: ENSMUSP00000037477
Gene: ENSMUSG00000034057

DomainStartEndE-ValueType
Pfam:NDT80_PhoG 252 399 3.4e-29 PFAM
Pfam:Peptidase_S74 446 505 1.6e-18 PFAM
Pfam:MRF_C1 525 560 1.8e-24 PFAM
low complexity region 562 601 N/A INTRINSIC
transmembrane domain 625 647 N/A INTRINSIC
low complexity region 663 691 N/A INTRINSIC
Pfam:MRF_C2 765 903 4e-53 PFAM
Meta Mutation Damage Score 0.55 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Myrfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Myrfl APN 10 116796106 missense possibly damaging 0.46
IGL00824:Myrfl APN 10 116849359 splice site probably benign
IGL01074:Myrfl APN 10 116779585 missense possibly damaging 0.50
IGL01394:Myrfl APN 10 116822687 missense probably benign 0.01
IGL02283:Myrfl APN 10 116777360 missense probably benign 0.33
IGL02869:Myrfl APN 10 116829004 missense probably damaging 0.98
IGL02878:Myrfl APN 10 116777405 missense possibly damaging 0.70
IGL03112:Myrfl APN 10 116803406 missense probably benign 0.03
F5770:Myrfl UTSW 10 116861530 missense probably damaging 1.00
R0138:Myrfl UTSW 10 116849233 missense probably damaging 0.98
R0402:Myrfl UTSW 10 116828977 missense probably damaging 1.00
R0554:Myrfl UTSW 10 116828973 missense probably damaging 1.00
R0601:Myrfl UTSW 10 116776760 missense probably damaging 1.00
R0790:Myrfl UTSW 10 116817788 missense probably damaging 0.99
R0831:Myrfl UTSW 10 116783209 missense probably benign 0.06
R0931:Myrfl UTSW 10 116839449 missense probably benign 0.01
R0945:Myrfl UTSW 10 116803394 splice site probably benign
R1078:Myrfl UTSW 10 116776732 missense possibly damaging 0.94
R1187:Myrfl UTSW 10 116831542 missense probably damaging 1.00
R1432:Myrfl UTSW 10 116777427 missense probably damaging 1.00
R1762:Myrfl UTSW 10 116798593 missense probably damaging 1.00
R1827:Myrfl UTSW 10 116832947 missense probably damaging 0.99
R1952:Myrfl UTSW 10 116822811 missense probably benign 0.00
R2138:Myrfl UTSW 10 116795538 missense probably benign 0.00
R2317:Myrfl UTSW 10 116839384 missense possibly damaging 0.77
R2930:Myrfl UTSW 10 116817747 missense probably damaging 1.00
R3405:Myrfl UTSW 10 116822865 missense probably damaging 1.00
R4118:Myrfl UTSW 10 116828965 missense probably damaging 1.00
R4700:Myrfl UTSW 10 116777342 critical splice donor site probably null
R5039:Myrfl UTSW 10 116822711 missense probably damaging 1.00
R5097:Myrfl UTSW 10 116817704 missense probably damaging 1.00
R5138:Myrfl UTSW 10 116796058 critical splice donor site probably null
R5211:Myrfl UTSW 10 116798630 missense probably benign 0.00
R5249:Myrfl UTSW 10 116783233 missense probably benign
R5573:Myrfl UTSW 10 116822756 missense probably damaging 0.98
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6091:Myrfl UTSW 10 116849206 missense probably benign
R6315:Myrfl UTSW 10 116822819 missense possibly damaging 0.81
R6812:Myrfl UTSW 10 116832913 missense probably damaging 1.00
R6867:Myrfl UTSW 10 116848282 nonsense probably null
V7582:Myrfl UTSW 10 116861530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCCTTGACAACTGTAGGAGAG -3'
(R):5'- CATCAATGGAGGAGTGCCACTCAG -3'

Sequencing Primer
(F):5'- GATCTATGTCGCTAGAACAGTCTG -3'
(R):5'- gagagcaagccaataagcag -3'
Posted On2014-02-11