Incidental Mutation 'R1329:4931440F15Rik'
ID156124
Institutional Source Beutler Lab
Gene Symbol 4931440F15Rik
Ensembl Gene ENSMUSG00000078157
Gene NameRIKEN cDNA 4931440F15 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29822395-29825668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29823553 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 635 (N635Y)
Ref Sequence ENSEMBL: ENSMUSP00000100568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104962
AA Change: N635Y

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157
AA Change: N635Y

DomainStartEndE-ValueType
ANK 19 50 1.53e3 SMART
ANK 57 87 1.7e-3 SMART
ANK 99 128 3.6e-2 SMART
ANK 132 162 3.31e-1 SMART
ANK 166 195 8.19e-6 SMART
ANK 199 228 7.83e-3 SMART
ANK 231 260 1.8e-2 SMART
low complexity region 297 306 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
ANK 536 578 8.39e-3 SMART
ANK 582 611 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109452
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in 4931440F15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:4931440F15Rik APN 11 29824755 missense probably damaging 1.00
IGL01560:4931440F15Rik APN 11 29824643 nonsense probably null
IGL02160:4931440F15Rik APN 11 29823593 nonsense probably null
IGL03058:4931440F15Rik APN 11 29824656 missense probably benign 0.01
IGL03107:4931440F15Rik APN 11 29824360 missense probably damaging 1.00
R0504:4931440F15Rik UTSW 11 29824990 missense probably damaging 1.00
R0615:4931440F15Rik UTSW 11 29824515 missense probably damaging 1.00
R1167:4931440F15Rik UTSW 11 29823567 missense probably damaging 1.00
R1525:4931440F15Rik UTSW 11 29823994 missense probably benign 0.11
R1745:4931440F15Rik UTSW 11 29824723 missense probably benign
R1917:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R1918:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R2338:4931440F15Rik UTSW 11 29823718 missense probably benign 0.01
R4359:4931440F15Rik UTSW 11 29824669 missense probably benign 0.12
R4757:4931440F15Rik UTSW 11 29825454 start codon destroyed probably null 1.00
R4859:4931440F15Rik UTSW 11 29825178 missense probably damaging 1.00
R5595:4931440F15Rik UTSW 11 29824288 missense probably benign 0.00
Z1088:4931440F15Rik UTSW 11 29825007 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAAGGAGACAGCTTTGCTCAC -3'
(R):5'- ATCGCTGCCCAGAACAATTGCC -3'

Sequencing Primer
(F):5'- TGCAGGACTCTAGGACAGTG -3'
(R):5'- GAACAATTGCCCGGCCATC -3'
Posted On2014-02-11