Incidental Mutation 'R1329:Atg101'
ID156126
Institutional Source Beutler Lab
Gene Symbol Atg101
Ensembl Gene ENSMUSG00000037204
Gene Nameautophagy related 101
Synonyms9430023L20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101284272-101290945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101290290 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 92 (G92D)
Ref Sequence ENSEMBL: ENSMUSP00000154855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048393] [ENSMUST00000071328] [ENSMUST00000191426] [ENSMUST00000229525] [ENSMUST00000230525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048393
AA Change: G92D

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045474
Gene: ENSMUSG00000037204
AA Change: G92D

DomainStartEndE-ValueType
Pfam:DUF1649 9 172 4.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071328
SMART Domains Protein: ENSMUSP00000071291
Gene: ENSMUSG00000075408

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071328
Predicted Effect probably benign
Transcript: ENSMUST00000191426
Predicted Effect probably null
Transcript: ENSMUST00000229525
Predicted Effect probably null
Transcript: ENSMUST00000230525
AA Change: G92D

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Atg101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Atg101 APN 15 101287095 missense possibly damaging 0.94
IGL02056:Atg101 APN 15 101290337 missense probably damaging 0.99
IGL03237:Atg101 APN 15 101287173 missense probably damaging 0.99
R2096:Atg101 UTSW 15 101290501 missense possibly damaging 0.85
R4622:Atg101 UTSW 15 101293332 unclassified probably benign
R6159:Atg101 UTSW 15 101290638 missense possibly damaging 0.52
R6414:Atg101 UTSW 15 101290460 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATCACAAGTCCTCCTCTAGGTC -3'
(R):5'- CGTGTCAAACACGTTGTCCACCTC -3'

Sequencing Primer
(F):5'- AAGTCCTCCTCTAGGTCTGTCTG -3'
(R):5'- CGATGTTAATGATCTTCTCGCACAG -3'
Posted On2014-02-11