Incidental Mutation 'R1330:Wap'
ID156150
Institutional Source Beutler Lab
Gene Symbol Wap
Ensembl Gene ENSMUSG00000000381
Gene Namewhey acidic protein
Synonyms
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6635482-6638637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6636818 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000099974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102910]
Predicted Effect unknown
Transcript: ENSMUST00000102910
AA Change: T94A
SMART Domains Protein: ENSMUSP00000099974
Gene: ENSMUSG00000000381
AA Change: T94A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
internal_repeat_1 46 75 4.46e-5 PROSPERO
WAP 79 128 1.96e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141868
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Homozygous mutants are phenotypically normal and fertile. Functional differentiation of mammary epithelium is normal and dams produce milk, but pups thrive poorly on milk lacking whey acidic protein. A normal variant determines a one amino acid change inWAP protein in YBR versus other strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Wap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Wap APN 11 6636808 missense probably damaging 0.98
R0899:Wap UTSW 11 6636725 missense probably benign 0.00
R3783:Wap UTSW 11 6638550 nonsense probably null
R3785:Wap UTSW 11 6638550 nonsense probably null
R3786:Wap UTSW 11 6638550 nonsense probably null
R3787:Wap UTSW 11 6638550 nonsense probably null
R5022:Wap UTSW 11 6637339 splice site probably benign
R5065:Wap UTSW 11 6636840 missense probably damaging 0.96
R5664:Wap UTSW 11 6638609 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGATTGGCTAGGACATTCTCCTCC -3'
(R):5'- GCTGCCTGACCATAAGACAGACTTC -3'

Sequencing Primer
(F):5'- GGTCTCACATTGTATCTGCACTTG -3'
(R):5'- GACTTCAACAAATGCCCCATTC -3'
Posted On2014-02-11