Incidental Mutation 'R1331:Hdlbp'
ID156169
Institutional Source Beutler Lab
Gene Symbol Hdlbp
Ensembl Gene ENSMUSG00000034088
Gene Namehigh density lipoprotein (HDL) binding protein
Synonyms1110005P14Rik, D1Ertd101e
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R1331 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93405940-93478815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93421131 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 566 (N566Y)
Ref Sequence ENSEMBL: ENSMUSP00000139671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042498] [ENSMUST00000170883] [ENSMUST00000186164]
Predicted Effect probably damaging
Transcript: ENSMUST00000042498
AA Change: N635Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043047
Gene: ENSMUSG00000034088
AA Change: N635Y

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096427
SMART Domains Protein: ENSMUSP00000126949
Gene: ENSMUSG00000090489

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 124 218 8.2e-25 PFAM
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170883
AA Change: N635Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088
AA Change: N635Y

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186164
AA Change: N566Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139671
Gene: ENSMUSG00000034088
AA Change: N566Y

DomainStartEndE-ValueType
KH 149 217 1.2e-17 SMART
KH 221 289 1.1e-11 SMART
KH 294 360 1.6e-14 SMART
KH 365 433 5.7e-18 SMART
KH 437 506 4.6e-14 SMART
KH 511 579 4.7e-20 SMART
KH 583 652 2e-18 SMART
KH 657 726 7.9e-15 SMART
KH 730 799 1.5e-14 SMART
KH 803 903 1.8e-18 SMART
KH 904 970 2.8e-13 SMART
KH 982 1053 2.2e-17 SMART
KH 1057 1126 2e-16 SMART
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Acat1 T C 9: 53,584,883 D318G probably benign Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Arhgef26 A G 3: 62,340,028 T178A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Ccdc39 T C 3: 33,815,485 E731G probably benign Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
Col14a1 T A 15: 55,410,188 W718R unknown Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Ralgapb T C 2: 158,430,533 F169S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Slc45a4 C T 15: 73,586,747 D326N probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Hdlbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Hdlbp APN 1 93430169 missense probably benign 0.00
IGL01321:Hdlbp APN 1 93423802 missense probably damaging 1.00
IGL01387:Hdlbp APN 1 93413588 missense possibly damaging 0.91
IGL01443:Hdlbp APN 1 93431074 missense probably damaging 0.99
IGL01467:Hdlbp APN 1 93417698 splice site probably benign
IGL02223:Hdlbp APN 1 93412449 missense probably damaging 1.00
IGL02274:Hdlbp APN 1 93408507 splice site probably null
IGL02452:Hdlbp APN 1 93417511 missense probably damaging 1.00
IGL03079:Hdlbp APN 1 93413940 splice site probably benign
IGL03169:Hdlbp APN 1 93416587 missense possibly damaging 0.92
IGL03229:Hdlbp APN 1 93430187 missense probably benign 0.00
R0119:Hdlbp UTSW 1 93421337 splice site probably benign
R0432:Hdlbp UTSW 1 93425332 missense probably damaging 1.00
R0508:Hdlbp UTSW 1 93414811 critical splice donor site probably null
R0530:Hdlbp UTSW 1 93430317 unclassified probably benign
R1276:Hdlbp UTSW 1 93421101 missense probably benign 0.12
R1302:Hdlbp UTSW 1 93423385 splice site probably null
R1537:Hdlbp UTSW 1 93417374 missense probably benign 0.01
R1623:Hdlbp UTSW 1 93423869 missense probably damaging 1.00
R1695:Hdlbp UTSW 1 93437200 missense probably damaging 1.00
R1897:Hdlbp UTSW 1 93422285 intron probably benign
R1900:Hdlbp UTSW 1 93422237 intron probably benign
R1984:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R1985:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R2066:Hdlbp UTSW 1 93421880 intron probably benign
R2277:Hdlbp UTSW 1 93408178 nonsense probably null
R2349:Hdlbp UTSW 1 93422234 intron probably benign
R3434:Hdlbp UTSW 1 93428161 missense probably benign 0.04
R3978:Hdlbp UTSW 1 93421351 missense probably damaging 1.00
R4645:Hdlbp UTSW 1 93422120 intron probably benign
R5196:Hdlbp UTSW 1 93420193 missense probably damaging 1.00
R5760:Hdlbp UTSW 1 93440777 intron probably benign
R6327:Hdlbp UTSW 1 93429464 missense possibly damaging 0.87
R6420:Hdlbp UTSW 1 93431004 missense probably damaging 1.00
R6428:Hdlbp UTSW 1 93431445 missense possibly damaging 0.91
R6468:Hdlbp UTSW 1 93417667 missense possibly damaging 0.48
R6488:Hdlbp UTSW 1 93428224 missense probably damaging 1.00
R6592:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R6920:Hdlbp UTSW 1 93412361 critical splice donor site probably null
Z1088:Hdlbp UTSW 1 93431354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCCAGGCTTAAAGCTCATGTC -3'
(R):5'- ACACTTGACCCTCTGACCTGAATCC -3'

Sequencing Primer
(F):5'- TGAGCCTGGAAGACTCTGATAG -3'
(R):5'- AGCCCTAAAGCCTTTGTGG -3'
Posted On2014-02-11