Incidental Mutation 'R1331:Ralgapb'
ID156175
Institutional Source Beutler Lab
Gene Symbol Ralgapb
Ensembl Gene ENSMUSG00000027652
Gene NameRal GTPase activating protein, beta subunit (non-catalytic)
SynonymsB230339M05Rik
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1331 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158409848-158499253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158430533 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 169 (F169S)
Ref Sequence ENSEMBL: ENSMUSP00000105112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486]
Predicted Effect probably damaging
Transcript: ENSMUST00000046274
AA Change: F169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: F169S

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 775 788 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1309 1321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109485
AA Change: F169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: F169S

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 926 936 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1325 1337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109486
AA Change: F169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: F169S

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173137
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Acat1 T C 9: 53,584,883 D318G probably benign Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Arhgef26 A G 3: 62,340,028 T178A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Ccdc39 T C 3: 33,815,485 E731G probably benign Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
Col14a1 T A 15: 55,410,188 W718R unknown Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hdlbp T A 1: 93,421,131 N566Y probably damaging Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Slc45a4 C T 15: 73,586,747 D326N probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Ralgapb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ralgapb APN 2 158420856 missense probably damaging 1.00
IGL00534:Ralgapb APN 2 158430500 missense possibly damaging 0.72
IGL01362:Ralgapb APN 2 158435465 missense probably damaging 1.00
IGL01653:Ralgapb APN 2 158462159 missense possibly damaging 0.94
IGL01704:Ralgapb APN 2 158420875 missense possibly damaging 0.92
IGL02000:Ralgapb APN 2 158454114 splice site probably benign
IGL02169:Ralgapb APN 2 158426204 missense probably damaging 1.00
IGL02516:Ralgapb APN 2 158465815 splice site probably benign
IGL02548:Ralgapb APN 2 158444665 missense probably damaging 0.97
IGL02550:Ralgapb APN 2 158448411 missense probably damaging 1.00
IGL02653:Ralgapb APN 2 158443309 missense probably damaging 1.00
IGL02744:Ralgapb APN 2 158446151 missense probably damaging 1.00
IGL02804:Ralgapb APN 2 158426284 missense possibly damaging 0.78
IGL02937:Ralgapb APN 2 158493016 splice site probably null
IGL02993:Ralgapb APN 2 158437394 missense possibly damaging 0.90
IGL03154:Ralgapb APN 2 158432866 missense probably damaging 1.00
IGL03204:Ralgapb APN 2 158465912 missense possibly damaging 0.67
IGL03347:Ralgapb APN 2 158465960 missense possibly damaging 0.67
PIT4142001:Ralgapb UTSW 2 158430422 missense probably benign 0.34
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0077:Ralgapb UTSW 2 158473249 missense probably damaging 1.00
R0581:Ralgapb UTSW 2 158492961 missense probably benign
R0629:Ralgapb UTSW 2 158439547 missense probably damaging 1.00
R0839:Ralgapb UTSW 2 158473283 critical splice donor site probably null
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1540:Ralgapb UTSW 2 158465826 missense probably benign 0.00
R1572:Ralgapb UTSW 2 158446199 splice site probably benign
R1628:Ralgapb UTSW 2 158430463 missense probably benign 0.04
R1718:Ralgapb UTSW 2 158443280 nonsense probably null
R1777:Ralgapb UTSW 2 158462195 missense probably damaging 1.00
R1822:Ralgapb UTSW 2 158492452 missense probably damaging 0.99
R1903:Ralgapb UTSW 2 158495563 missense probably benign 0.04
R1909:Ralgapb UTSW 2 158444675 missense probably damaging 1.00
R2157:Ralgapb UTSW 2 158437472 missense probably benign 0.15
R4524:Ralgapb UTSW 2 158437306 missense probably benign 0.00
R4946:Ralgapb UTSW 2 158440967 missense probably damaging 1.00
R4975:Ralgapb UTSW 2 158435508 missense possibly damaging 0.66
R5014:Ralgapb UTSW 2 158495535 missense probably damaging 1.00
R5165:Ralgapb UTSW 2 158465912 missense possibly damaging 0.67
R5465:Ralgapb UTSW 2 158448405 missense possibly damaging 0.81
R5526:Ralgapb UTSW 2 158432785 missense probably damaging 1.00
R5566:Ralgapb UTSW 2 158494710 missense possibly damaging 0.90
R5949:Ralgapb UTSW 2 158454259 missense probably damaging 1.00
R6140:Ralgapb UTSW 2 158456572 missense probably damaging 1.00
R6175:Ralgapb UTSW 2 158446155 missense probably damaging 1.00
R6192:Ralgapb UTSW 2 158449447 intron probably null
R6364:Ralgapb UTSW 2 158462109 missense probably damaging 1.00
R6458:Ralgapb UTSW 2 158444620 missense probably damaging 1.00
R6746:Ralgapb UTSW 2 158476136 missense probably damaging 1.00
R6782:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R6788:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R7017:Ralgapb UTSW 2 158448337 missense probably benign 0.19
R7108:Ralgapb UTSW 2 158492460 missense probably damaging 0.98
R7108:Ralgapb UTSW 2 158494662 missense probably damaging 1.00
R7236:Ralgapb UTSW 2 158440827 missense probably benign 0.34
R7454:Ralgapb UTSW 2 158432902 missense possibly damaging 0.94
R7485:Ralgapb UTSW 2 158443355 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CAGTGTCACTGGACCACTGTTCTAC -3'
(R):5'- cccccaacCCATGTTGTATCTTTCC -3'

Sequencing Primer
(F):5'- CTGGACCACTGTTCTACATCAGTAAG -3'
(R):5'- CCAACCGAAAAATTGTTTGTCAAC -3'
Posted On2014-02-11