Mutagenetix > Incidental Mutation

Incidental Mutation 'R1354:Tgm3'

156235

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

we, TG E

MMRRC Submission

039419-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1354 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129854269-129892319 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129883818 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 492 (I492T)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

AlphaFold

Q08189

Predicted Effect

probably benign
Transcript: ENSMUST00000110299
AA Change: I492T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: I492T

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atoh1	A	G	6: 64,706,341 (GRCm39)	E12G	possibly damaging	Het
Ccdc183	T	C	2: 25,502,151 (GRCm39)	N241S	probably benign	Het
Cmya5	G	A	13: 93,228,566 (GRCm39)	T2174I	possibly damaging	Het
Edem1	A	G	6: 108,831,277 (GRCm39)	I579M	possibly damaging	Het
Gimap9	A	T	6: 48,654,982 (GRCm39)	M190L	probably benign	Het
Glod4	A	T	11: 76,128,654 (GRCm39)		probably null	Het
Ighv8-6	A	T	12: 115,129,700 (GRCm39)	S19T	probably damaging	Het
Lef1	C	T	3: 130,988,317 (GRCm39)	P267S	probably damaging	Het
Megf11	A	G	9: 64,560,459 (GRCm39)	E335G	probably benign	Het
Muc5ac	A	G	7: 141,361,114 (GRCm39)	N1475S	probably damaging	Het
Ndst2	C	A	14: 20,775,043 (GRCm39)	R749L	possibly damaging	Het
Oas3	C	A	5: 120,908,065 (GRCm39)	V292L	possibly damaging	Het
Phactr1	A	T	13: 43,210,807 (GRCm39)	I210F	possibly damaging	Het
Plppr5	G	A	3: 117,369,496 (GRCm39)	R51H	possibly damaging	Het
Ppp1r12b	G	A	1: 134,763,721 (GRCm39)	T771M	probably benign	Het
Rasgrf2	G	A	13: 92,165,174 (GRCm39)	P331S	probably damaging	Het
Rtl6	C	T	15: 84,440,728 (GRCm39)	V223M	probably damaging	Het
Tbc1d9	A	C	8: 83,995,610 (GRCm39)		probably null	Het
Trdv1	T	A	14: 54,119,375 (GRCm39)		probably benign	Het
Wdr45b	A	T	11: 121,226,256 (GRCm39)	I191N	probably damaging	Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	129,880,333 (GRCm39)	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	129,880,294 (GRCm39)	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	129,866,414 (GRCm39)	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	129,886,488 (GRCm39)	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	129,889,660 (GRCm39)	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	129,866,438 (GRCm39)	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	129,871,961 (GRCm39)	splice site	probably null
IGL02449:Tgm3	APN	2	129,880,529 (GRCm39)	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	129,883,899 (GRCm39)	missense	probably damaging	1.00
tortellini	UTSW	2	129,866,505 (GRCm39)	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	129,890,310 (GRCm39)	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	129,886,582 (GRCm39)	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	129,868,602 (GRCm39)	splice site	probably benign
R0834:Tgm3	UTSW	2	129,868,677 (GRCm39)	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	129,868,602 (GRCm39)	splice site	probably benign
R0940:Tgm3	UTSW	2	129,854,326 (GRCm39)	missense	probably benign	0.00
R1642:Tgm3	UTSW	2	129,889,702 (GRCm39)	missense	probably damaging	1.00
R1670:Tgm3	UTSW	2	129,883,688 (GRCm39)	nonsense	probably null
R1715:Tgm3	UTSW	2	129,868,734 (GRCm39)	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	129,871,889 (GRCm39)	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	129,879,403 (GRCm39)	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	129,889,692 (GRCm39)	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	129,889,692 (GRCm39)	missense	possibly damaging	0.84
R4231:Tgm3	UTSW	2	129,886,509 (GRCm39)	nonsense	probably null
R4296:Tgm3	UTSW	2	129,880,333 (GRCm39)	missense	possibly damaging	0.77
R4794:Tgm3	UTSW	2	129,883,875 (GRCm39)	missense	probably benign	0.00
R4948:Tgm3	UTSW	2	129,890,240 (GRCm39)	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	129,879,404 (GRCm39)	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	129,890,202 (GRCm39)	missense	possibly damaging	0.95
R5786:Tgm3	UTSW	2	129,868,704 (GRCm39)	nonsense	probably null
R6030:Tgm3	UTSW	2	129,883,920 (GRCm39)	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	129,883,920 (GRCm39)	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	129,867,221 (GRCm39)	nonsense	probably null
R6219:Tgm3	UTSW	2	129,880,530 (GRCm39)	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	129,883,890 (GRCm39)	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	129,883,949 (GRCm39)	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	129,868,697 (GRCm39)	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	129,866,481 (GRCm39)	missense	probably benign	0.00
R7317:Tgm3	UTSW	2	129,890,211 (GRCm39)	missense	probably benign	0.09
R7513:Tgm3	UTSW	2	129,866,324 (GRCm39)	missense	probably benign	0.00
R7517:Tgm3	UTSW	2	129,883,684 (GRCm39)	missense	probably benign	0.01
R7793:Tgm3	UTSW	2	129,854,330 (GRCm39)	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	129,883,819 (GRCm39)	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	129,880,400 (GRCm39)	missense	probably benign
R8747:Tgm3	UTSW	2	129,886,452 (GRCm39)	missense	probably benign	0.03
R8805:Tgm3	UTSW	2	129,889,702 (GRCm39)	missense	probably damaging	1.00
R8987:Tgm3	UTSW	2	129,880,403 (GRCm39)	missense	probably benign	0.00
R9029:Tgm3	UTSW	2	129,871,680 (GRCm39)	missense	probably benign	0.00
R9208:Tgm3	UTSW	2	129,865,618 (GRCm39)	missense	possibly damaging	0.76
R9423:Tgm3	UTSW	2	129,880,527 (GRCm39)	missense	probably benign	0.01
R9713:Tgm3	UTSW	2	129,867,229 (GRCm39)	missense	possibly damaging	0.74
X0065:Tgm3	UTSW	2	129,866,430 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGTTTCCCTCGCCAATGCACAG -3'
(R):5'- CCTTGCTCATAAGACAGCAGCTTCC -3'

Sequencing Primer
(F):5'- CAATGCACAGGTTCCAGTG -3'
(R):5'- CAGGATGAGTCAGTTACCTTCTTCAG -3'

Posted On

2014-02-11