Incidental Mutation 'R1355:Lrrcc1'
ID156264
Institutional Source Beutler Lab
Gene Symbol Lrrcc1
Ensembl Gene ENSMUSG00000027550
Gene Nameleucine rich repeat and coiled-coil domain containing 1
Synonyms
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1355 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14533788-14572658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 14548114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 299 (V299L)
Ref Sequence ENSEMBL: ENSMUSP00000128733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000167858] [ENSMUST00000169079]
Predicted Effect probably benign
Transcript: ENSMUST00000091325
AA Change: V405L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: V405L

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 126 4.8e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
coiled coil region 412 626 N/A INTRINSIC
coiled coil region 675 718 N/A INTRINSIC
coiled coil region 757 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108370
AA Change: V421L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: V421L

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 124 4.5e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163660
AA Change: V299L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: V299L

DomainStartEndE-ValueType
Blast:LRR 8 29 7e-6 BLAST
SCOP:d1dcea3 9 71 9e-4 SMART
low complexity region 167 179 N/A INTRINSIC
coiled coil region 306 520 N/A INTRINSIC
coiled coil region 569 612 N/A INTRINSIC
coiled coil region 651 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165436
SMART Domains Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Pfam:LRR_9 32 154 4e-10 PFAM
Pfam:LRR_6 60 83 1.4e-4 PFAM
Pfam:LRR_4 60 103 6.2e-11 PFAM
Pfam:LRR_8 60 116 8.1e-11 PFAM
Pfam:LRR_1 61 81 3.3e-4 PFAM
Pfam:LRR_6 78 105 3.4e-3 PFAM
Pfam:LRR_4 82 125 4.9e-9 PFAM
Pfam:LRR_6 103 125 5.1e-4 PFAM
Pfam:LRR_4 104 149 1.2e-8 PFAM
Pfam:LRR_1 105 128 3.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167858
SMART Domains Protein: ENSMUSP00000129368
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 7 221 N/A INTRINSIC
coiled coil region 270 313 N/A INTRINSIC
low complexity region 450 472 N/A INTRINSIC
SCOP:d1ek8a_ 494 550 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169079
AA Change: V421L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: V421L

DomainStartEndE-ValueType
Pfam:LRR_4 60 102 4.3e-9 PFAM
internal_repeat_1 109 145 1.05e-6 PROSPERO
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169799
SMART Domains Protein: ENSMUSP00000126592
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 1 131 N/A INTRINSIC
coiled coil region 200 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171620
SMART Domains Protein: ENSMUSP00000128252
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 30 91 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Lrrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Lrrcc1 APN 3 14536128 missense possibly damaging 0.91
IGL01325:Lrrcc1 APN 3 14536541 critical splice donor site probably null
IGL01681:Lrrcc1 APN 3 14548226 missense probably benign 0.35
IGL01767:Lrrcc1 APN 3 14547272 missense probably damaging 0.97
IGL01868:Lrrcc1 APN 3 14554357 nonsense probably null
IGL03123:Lrrcc1 APN 3 14536084 missense probably damaging 0.97
PIT1430001:Lrrcc1 UTSW 3 14545596 missense probably damaging 0.99
R0295:Lrrcc1 UTSW 3 14565849 missense probably benign 0.05
R0427:Lrrcc1 UTSW 3 14558356 missense probably damaging 1.00
R0433:Lrrcc1 UTSW 3 14559374 missense probably damaging 1.00
R0534:Lrrcc1 UTSW 3 14557273 missense probably damaging 1.00
R0631:Lrrcc1 UTSW 3 14540119 splice site probably benign
R0635:Lrrcc1 UTSW 3 14559228 missense probably benign 0.11
R1370:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1727:Lrrcc1 UTSW 3 14537363 missense probably damaging 0.99
R1822:Lrrcc1 UTSW 3 14559225 unclassified probably benign
R1946:Lrrcc1 UTSW 3 14550393 missense probably benign 0.02
R2254:Lrrcc1 UTSW 3 14547255 missense probably damaging 1.00
R2362:Lrrcc1 UTSW 3 14563024 missense probably damaging 1.00
R2392:Lrrcc1 UTSW 3 14536520 missense probably damaging 1.00
R4105:Lrrcc1 UTSW 3 14550328 missense probably benign 0.21
R4464:Lrrcc1 UTSW 3 14557318 missense probably damaging 1.00
R4484:Lrrcc1 UTSW 3 14551443 missense probably damaging 1.00
R4543:Lrrcc1 UTSW 3 14539791 missense probably damaging 0.98
R4718:Lrrcc1 UTSW 3 14536032 missense probably damaging 1.00
R4734:Lrrcc1 UTSW 3 14562285 missense probably damaging 1.00
R4799:Lrrcc1 UTSW 3 14536096 nonsense probably null
R4841:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R4842:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R5900:Lrrcc1 UTSW 3 14562126 missense possibly damaging 0.69
R6338:Lrrcc1 UTSW 3 14547316 missense possibly damaging 0.48
R7001:Lrrcc1 UTSW 3 14540095 missense probably damaging 0.99
R7036:Lrrcc1 UTSW 3 14563009 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGGCGGGATACTGAACCTCTTCAAA -3'
(R):5'- ACAGTGTTGCCTTACCTATCTGTGGT -3'

Sequencing Primer
(F):5'- GTCTTGTTAGTTGTCATGAAACCC -3'
(R):5'- ACCTATCTGTGGTAATGAGAGCC -3'
Posted On2014-02-11