Incidental Mutation 'R1355:Rer1'
ID156270
Institutional Source Beutler Lab
Gene Symbol Rer1
Ensembl Gene ENSMUSG00000029048
Gene Nameretention in endoplasmic reticulum sorting receptor 1
Synonyms
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1355 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155074110-155086382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155075624 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 156 (M156L)
Ref Sequence ENSEMBL: ENSMUSP00000030914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030914] [ENSMUST00000103180]
Predicted Effect probably benign
Transcript: ENSMUST00000030914
AA Change: M156L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030914
Gene: ENSMUSG00000029048
AA Change: M156L

DomainStartEndE-ValueType
Pfam:Rer1 20 185 4.1e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103180
SMART Domains Protein: ENSMUSP00000099469
Gene: ENSMUSG00000029047

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 16 241 2.3e-43 PFAM
low complexity region 248 260 N/A INTRINSIC
RING 271 308 4.48e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149796
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein that is localized to the golgi apparatus. It is involved in the retention of endoplasmic reticulum (ER) membrane proteins in the ER and retrieval of ER membrane proteins from the early Golgi compartment to facilitate gamma-secretase complex assembly. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit a slight reduction in the size of neuromuscular junctions and muscle fiber diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Rer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Rer1 APN 4 155082665 critical splice donor site probably null
R1370:Rer1 UTSW 4 155075624 missense probably benign 0.00
R1564:Rer1 UTSW 4 155075593 missense probably damaging 1.00
R1722:Rer1 UTSW 4 155075001 missense probably damaging 0.99
R1907:Rer1 UTSW 4 155078499 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGAAGCCGAGCACAGTCAGTCATC -3'
(R):5'- TTTGGACCAAATGTCCCCTGGAGC -3'

Sequencing Primer
(F):5'- TCACACACAGAAAGCGATGG -3'
(R):5'- CAAAGGAGCCAAAGTCTTTGTTG -3'
Posted On2014-02-11