Incidental Mutation 'R1355:Olfr1466'
ID156308
Institutional Source Beutler Lab
Gene Symbol Olfr1466
Ensembl Gene ENSMUSG00000096485
Gene Nameolfactory receptor 1466
SynonymsMOR202-12, GA_x6K02T2RE5P-3672907-3673839
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1355 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13338862-13343572 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13342518 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 253 (Y253*)
Ref Sequence ENSEMBL: ENSMUSP00000147188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075868] [ENSMUST00000207124]
Predicted Effect probably null
Transcript: ENSMUST00000075868
AA Change: Y253*
SMART Domains Protein: ENSMUSP00000075265
Gene: ENSMUSG00000096485
AA Change: Y253*

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 4.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.9e-6 PFAM
Pfam:7tm_1 42 291 7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207124
AA Change: Y253*
Meta Mutation Damage Score 0.6256 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Olfr1466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Olfr1466 APN 19 13342120 missense probably benign 0.13
IGL02568:Olfr1466 APN 19 13342219 missense probably benign 0.08
IGL03073:Olfr1466 APN 19 13342022 missense probably benign 0.00
R0943:Olfr1466 UTSW 19 13341793 missense probably benign 0.00
R1301:Olfr1466 UTSW 19 13341847 missense probably benign 0.05
R1524:Olfr1466 UTSW 19 13342122 nonsense probably null
R1568:Olfr1466 UTSW 19 13342175 missense probably benign 0.14
R1993:Olfr1466 UTSW 19 13341814 missense possibly damaging 0.65
R2031:Olfr1466 UTSW 19 13342406 missense probably benign 0.18
R3693:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3694:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3853:Olfr1466 UTSW 19 13342498 missense possibly damaging 0.55
R5313:Olfr1466 UTSW 19 13342065 missense probably benign 0.07
R5467:Olfr1466 UTSW 19 13342157 missense probably damaging 1.00
R6060:Olfr1466 UTSW 19 13342133 missense probably benign 0.08
R7125:Olfr1466 UTSW 19 13341739 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCAGCAATCATGGCTCTCTC -3'
(R):5'- TGTTCCTTCATGTCCAGGCCAAAATG -3'

Sequencing Primer
(F):5'- GGCTCTCTCTTGCTCTGATAGAC -3'
(R):5'- GTCCAGGCCAAAATGATATTCATAGG -3'
Posted On2014-02-11