Incidental Mutation 'R1356:Inpp1'
ID156311
Institutional Source Beutler Lab
Gene Symbol Inpp1
Ensembl Gene ENSMUSG00000026102
Gene Nameinositol polyphosphate-1-phosphatase
Synonyms2300002C06Rik
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1356 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52785427-52817688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52797056 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 84 (F84L)
Ref Sequence ENSEMBL: ENSMUSP00000027271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027271] [ENSMUST00000159725] [ENSMUST00000162576] [ENSMUST00000177279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027271
AA Change: F84L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027271
Gene: ENSMUSG00000026102
AA Change: F84L

DomainStartEndE-ValueType
Pfam:Inositol_P 56 378 5.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159607
Predicted Effect probably benign
Transcript: ENSMUST00000159725
SMART Domains Protein: ENSMUSP00000123977
Gene: ENSMUSG00000026102

DomainStartEndE-ValueType
PDB:1INP|A 1 80 4e-36 PDB
SCOP:d1inp__ 1 80 8e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162351
Predicted Effect probably benign
Transcript: ENSMUST00000162576
AA Change: F84L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124890
Gene: ENSMUSG00000026102
AA Change: F84L

DomainStartEndE-ValueType
PDB:1INP|A 1 90 8e-43 PDB
SCOP:d1inp__ 1 90 5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177279
SMART Domains Protein: ENSMUSP00000135225
Gene: ENSMUSG00000026102

DomainStartEndE-ValueType
PDB:1INP|A 1 68 8e-27 PDB
SCOP:d1inp__ 1 68 1e-31 SMART
low complexity region 71 90 N/A INTRINSIC
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme inositol polyphosphate-1-phosphatase, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 1 of the inositol ring from the polyphosphates inositol 1,4-bisphosphate and inositol 1,3,4-trisphophosphate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a targeted allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Inpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Inpp1 APN 1 52799327 missense probably damaging 1.00
R0344:Inpp1 UTSW 1 52799354 missense probably damaging 1.00
R1465:Inpp1 UTSW 1 52790094 missense probably benign
R1465:Inpp1 UTSW 1 52790094 missense probably benign
R1907:Inpp1 UTSW 1 52789670 makesense probably null
R1954:Inpp1 UTSW 1 52794629 missense probably damaging 1.00
R2033:Inpp1 UTSW 1 52790173 missense possibly damaging 0.71
R2104:Inpp1 UTSW 1 52799418 missense probably damaging 1.00
R2224:Inpp1 UTSW 1 52790131 missense probably benign 0.07
R3508:Inpp1 UTSW 1 52799391 missense probably damaging 1.00
R4682:Inpp1 UTSW 1 52794601 missense probably benign 0.00
R5252:Inpp1 UTSW 1 52794547 missense probably benign 0.00
R5590:Inpp1 UTSW 1 52794661 missense probably damaging 0.96
R6354:Inpp1 UTSW 1 52797065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCACCAATGGACACATTAG -3'
(R):5'- CGCTTTCCTGGCAAAGGAGCAG -3'

Sequencing Primer
(F):5'- GGCTAAGTCACACTTACTAAGATGC -3'
(R):5'- GCTGACTTAGTTCCATGTTCAAG -3'
Posted On2014-02-11