Incidental Mutation 'R1356:Cfap45'
ID156313
Institutional Source Beutler Lab
Gene Symbol Cfap45
Ensembl Gene ENSMUSG00000026546
Gene Namecilia and flagella associated protein 45
Synonyms1700028D05Rik, Nesg1, Ccdc19
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R1356 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172520801-172545870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 172527863 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 26 (R26Q)
Ref Sequence ENSEMBL: ENSMUSP00000083057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085894] [ENSMUST00000159395] [ENSMUST00000159792] [ENSMUST00000161140] [ENSMUST00000162988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085894
AA Change: R26Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083057
Gene: ENSMUSG00000026546
AA Change: R26Q

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:TPH 187 532 1.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159395
SMART Domains Protein: ENSMUSP00000125224
Gene: ENSMUSG00000026546

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159792
SMART Domains Protein: ENSMUSP00000124540
Gene: ENSMUSG00000026546

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160531
Predicted Effect probably benign
Transcript: ENSMUST00000161140
Predicted Effect probably benign
Transcript: ENSMUST00000162988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194051
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Cfap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cfap45 APN 1 172535345 unclassified probably benign
IGL01936:Cfap45 APN 1 172534049 missense probably damaging 1.00
IGL03235:Cfap45 APN 1 172538493 missense possibly damaging 0.55
R0194:Cfap45 UTSW 1 172541327 missense probably benign 0.05
R0883:Cfap45 UTSW 1 172532189 missense possibly damaging 0.90
R1130:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1168:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1522:Cfap45 UTSW 1 172540572 missense probably damaging 1.00
R1921:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R1922:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R2203:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2204:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2205:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R3156:Cfap45 UTSW 1 172545724 missense possibly damaging 0.93
R4059:Cfap45 UTSW 1 172538489 missense probably benign 0.00
R4151:Cfap45 UTSW 1 172532221 missense probably damaging 0.98
R4445:Cfap45 UTSW 1 172535227 missense probably benign 0.07
R4548:Cfap45 UTSW 1 172545108 missense probably benign 0.00
R4582:Cfap45 UTSW 1 172529912 missense probably benign 0.42
R4909:Cfap45 UTSW 1 172529876 missense probably benign 0.14
R5200:Cfap45 UTSW 1 172545129 nonsense probably null
R5800:Cfap45 UTSW 1 172538600 missense probably damaging 0.98
R6520:Cfap45 UTSW 1 172540584 missense probably damaging 1.00
R6662:Cfap45 UTSW 1 172529850 missense probably benign 0.01
R7390:Cfap45 UTSW 1 172541358 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTTTTGCTGTATGCTCGCCC -3'
(R):5'- GCTGAACCCCTGGAAGTCAAAGAAG -3'

Sequencing Primer
(F):5'- GCCCTTCTAGCTGTCGG -3'
(R):5'- CTAGATGTCAGAGCCAGGATCTC -3'
Posted On2014-02-11