Incidental Mutation 'R1356:E2f8'
ID156323
Institutional Source Beutler Lab
Gene Symbol E2f8
Ensembl Gene ENSMUSG00000046179
Gene NameE2F transcription factor 8
Synonyms4432406C08Rik
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1356 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48866429-48881596 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 48880270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058745] [ENSMUST00000119223]
Predicted Effect probably benign
Transcript: ENSMUST00000058745
SMART Domains Protein: ENSMUSP00000056778
Gene: ENSMUSG00000046179

DomainStartEndE-ValueType
E2F_TDP 113 182 4.25e-29 SMART
E2F_TDP 261 347 2.26e-33 SMART
low complexity region 819 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119223
SMART Domains Protein: ENSMUSP00000112883
Gene: ENSMUSG00000046179

DomainStartEndE-ValueType
Pfam:E2F_TDP 113 182 8.9e-24 PFAM
Pfam:E2F_TDP 261 347 3e-21 PFAM
low complexity region 819 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210463
Meta Mutation Damage Score 0.0508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors which regulate the expression of genes required for progression through the cell cycle. The encoded protein regulates progression from G1 to S phase by ensuring the nucleus divides at the proper time. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele develop normally through puberty and live to old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in E2f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:E2f8 APN 7 48868203 missense probably damaging 1.00
IGL01121:E2f8 APN 7 48867821 nonsense probably null
IGL01351:E2f8 APN 7 48867151 missense probably benign 0.00
IGL01592:E2f8 APN 7 48867857 missense probably damaging 1.00
IGL01730:E2f8 APN 7 48877934 splice site probably benign
IGL02708:E2f8 APN 7 48867234 splice site probably null
R0535:E2f8 UTSW 7 48871810 splice site probably benign
R1902:E2f8 UTSW 7 48871172 missense probably benign 0.32
R1989:E2f8 UTSW 7 48873280 missense probably benign 0.30
R2109:E2f8 UTSW 7 48875107 missense probably damaging 1.00
R4126:E2f8 UTSW 7 48875607 missense probably damaging 0.99
R4384:E2f8 UTSW 7 48867099 missense possibly damaging 0.93
R4817:E2f8 UTSW 7 48867746 missense probably benign
R4939:E2f8 UTSW 7 48872138 missense probably benign 0.02
R4979:E2f8 UTSW 7 48875170 intron probably benign
R5274:E2f8 UTSW 7 48867177 missense probably damaging 0.97
R5624:E2f8 UTSW 7 48877961 missense probably damaging 1.00
R5677:E2f8 UTSW 7 48867195 missense probably damaging 0.99
R5940:E2f8 UTSW 7 48871077 missense probably benign 0.03
R5988:E2f8 UTSW 7 48874995 missense probably damaging 1.00
R6003:E2f8 UTSW 7 48870777 missense probably benign
R6107:E2f8 UTSW 7 48867676 missense probably benign 0.01
R6816:E2f8 UTSW 7 48875583 missense possibly damaging 0.46
R7329:E2f8 UTSW 7 48872110 missense probably damaging 1.00
R7343:E2f8 UTSW 7 48867965 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACAGCATTTGGAGGCCCAGTAG -3'
(R):5'- TCGAACCTGAGAGAGGACTGTCAC -3'

Sequencing Primer
(F):5'- GGTTACTTTAACCCTGGACAAC -3'
(R):5'- AGGCAATGTCTGTCCTCAAG -3'
Posted On2014-02-11