Incidental Mutation 'R1357:Hal'
ID156343
Institutional Source Beutler Lab
Gene Symbol Hal
Ensembl Gene ENSMUSG00000020017
Gene Namehistidine ammonia lyase
Synonymshistidase, Hsd
MMRRC Submission 039422-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1357 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93488768-93519304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93500623 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 405 (G405S)
Ref Sequence ENSEMBL: ENSMUSP00000123336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016031] [ENSMUST00000129421]
Predicted Effect probably benign
Transcript: ENSMUST00000016031
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129421
AA Change: G405S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017
AA Change: G405S

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152883
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the histidase protein family. The encoded protein is a cytosolic enzyme which catalyzes the first reaction in histidine catabolism. Defects in this protein cause histidinemia, which is characterized by increased histidine in blood, urine, and cerebrospinal fluid. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this gene cause elevated histidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 1 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Slc35e1 T C 8: 72,492,571 probably benign Het
Other mutations in Hal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hal APN 10 93490069 critical splice donor site probably null
IGL01528:Hal APN 10 93497593 missense probably damaging 1.00
IGL01818:Hal APN 10 93490984 missense probably damaging 0.99
IGL01903:Hal APN 10 93500607 splice site probably benign
IGL02152:Hal APN 10 93503542 missense possibly damaging 0.74
IGL02249:Hal APN 10 93497538 missense probably damaging 0.99
IGL02366:Hal APN 10 93503528 missense probably damaging 1.00
IGL02421:Hal APN 10 93503473 missense probably damaging 0.98
IGL02721:Hal APN 10 93507498 nonsense probably null
2k1 UTSW 10 93514143 critical splice donor site probably null
alger UTSW 10 93507551 critical splice donor site probably null
Whittaker UTSW 10 93516284 missense probably benign
R0048:Hal UTSW 10 93498991 missense probably damaging 1.00
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0372:Hal UTSW 10 93507553 splice site probably benign
R0465:Hal UTSW 10 93516284 missense probably benign
R0504:Hal UTSW 10 93489174 missense probably damaging 0.99
R1623:Hal UTSW 10 93516297 missense probably benign 0.00
R1757:Hal UTSW 10 93494628 missense probably benign 0.14
R1918:Hal UTSW 10 93496607 missense probably damaging 1.00
R2048:Hal UTSW 10 93491140 missense probably damaging 0.98
R2291:Hal UTSW 10 93503536 missense probably damaging 0.98
R3001:Hal UTSW 10 93507519 missense probably damaging 1.00
R3002:Hal UTSW 10 93507519 missense probably damaging 1.00
R3927:Hal UTSW 10 93514026 splice site probably benign
R3948:Hal UTSW 10 93489907 missense possibly damaging 0.94
R4394:Hal UTSW 10 93496559 intron probably benign
R4623:Hal UTSW 10 93507439 missense probably damaging 1.00
R4922:Hal UTSW 10 93503539 missense probably damaging 1.00
R5018:Hal UTSW 10 93507551 critical splice donor site probably null
R5072:Hal UTSW 10 93514042 missense probably damaging 0.99
R5073:Hal UTSW 10 93514042 missense probably damaging 0.99
R5074:Hal UTSW 10 93514042 missense probably damaging 0.99
R5303:Hal UTSW 10 93516365 utr 3 prime probably benign
R5806:Hal UTSW 10 93490984 missense probably damaging 0.97
R5992:Hal UTSW 10 93490916 missense probably damaging 1.00
R6294:Hal UTSW 10 93514143 critical splice donor site probably null
R6370:Hal UTSW 10 93497506 missense probably damaging 1.00
R6747:Hal UTSW 10 93500677 missense probably damaging 1.00
R7142:Hal UTSW 10 93500651 missense possibly damaging 0.85
R7299:Hal UTSW 10 93492561 missense probably benign 0.00
R7301:Hal UTSW 10 93492561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATCCATTGTCTGCGTTCCAAATC -3'
(R):5'- TCCGACTCTGACCTAGAAGAAGCC -3'

Sequencing Primer
(F):5'- aaatccacctgtctctgcc -3'
(R):5'- GGGGACCAACTCATCTAACTATG -3'
Posted On2014-02-11