Incidental Mutation 'R1363:Cdc14a'
List |< first << previous [record 71 of 585] next >> last >|
ID156352
Institutional Source Beutler Lab
Gene Symbol Cdc14a
Ensembl Gene ENSMUSG00000033502
Gene NameCDC14 cell division cycle 14A
SynonymsCDC14A2, Cdc14, CDC14a1, A830059A17Rik
MMRRC Submission 039428-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R1363 (G1)
Quality Score101
Status Not validated
Chromosome3
Chromosomal Location116272553-116424032 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CGCTGCTGCTGCTGCTGCTG to CGCTGCTGCTGCTGCTG at 116293860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090464] [ENSMUST00000106491]
Predicted Effect probably benign
Transcript: ENSMUST00000090464
SMART Domains Protein: ENSMUSP00000087950
Gene: ENSMUSG00000033502

DomainStartEndE-ValueType
Pfam:DSPn 13 153 1.6e-66 PFAM
Pfam:Y_phosphatase 210 324 1.1e-7 PFAM
Pfam:DSPc 214 328 1.8e-14 PFAM
low complexity region 539 558 N/A INTRINSIC
low complexity region 573 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106491
SMART Domains Protein: ENSMUSP00000102100
Gene: ENSMUSG00000033502

DomainStartEndE-ValueType
Pfam:DSPn 12 121 9.5e-44 PFAM
Pfam:Y_phosphatase 160 274 6.4e-8 PFAM
Pfam:DSPc 160 280 2.8e-14 PFAM
low complexity region 490 509 N/A INTRINSIC
low complexity region 524 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88b T A 19: 6,850,371 Y921F possibly damaging Het
Cct7 G T 6: 85,466,035 D265Y probably damaging Het
Csf1r A G 18: 61,124,845 M629V possibly damaging Het
Dlk1 G T 12: 109,455,504 G48V probably damaging Het
Fancc T C 13: 63,361,598 Y60C probably damaging Het
Ifi204 C T 1: 173,749,296 V580I probably benign Het
Irs1 A G 1: 82,287,288 V1069A probably benign Het
Plxna2 C T 1: 194,804,939 Q1601* probably null Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptpn14 C A 1: 189,798,628 F97L probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf6 A T 5: 146,211,559 F216L probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scyl3 A G 1: 163,950,690 I466V probably benign Het
Slc7a11 T C 3: 50,424,051 Y246C probably damaging Het
Stk33 A T 7: 109,279,821 S440R probably benign Het
Ttbk2 T C 2: 120,806,908 probably null Het
Vmn2r105 T A 17: 20,208,670 T715S probably benign Het
Other mutations in Cdc14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cdc14a APN 3 116294844 nonsense probably null
IGL01062:Cdc14a APN 3 116274712 splice site probably benign
IGL01584:Cdc14a APN 3 116392825 nonsense probably null
IGL03084:Cdc14a APN 3 116348452 critical splice donor site probably null
IGL03237:Cdc14a APN 3 116404626
IGL03296:Cdc14a APN 3 116297158 missense probably benign 0.02
PIT4131001:Cdc14a UTSW 3 116328661 missense possibly damaging 0.66
R0707:Cdc14a UTSW 3 116293713 splice site probably benign
R0782:Cdc14a UTSW 3 116322136 missense probably damaging 1.00
R0835:Cdc14a UTSW 3 116328522 missense probably benign 0.12
R1507:Cdc14a UTSW 3 116293997 missense possibly damaging 0.47
R1545:Cdc14a UTSW 3 116293724 critical splice donor site probably null
R1795:Cdc14a UTSW 3 116298473 missense possibly damaging 0.81
R1797:Cdc14a UTSW 3 116322194 missense probably damaging 1.00
R1830:Cdc14a UTSW 3 116422647 nonsense probably null
R4229:Cdc14a UTSW 3 116293764 missense probably damaging 0.99
R4655:Cdc14a UTSW 3 116328487 missense probably damaging 1.00
R4769:Cdc14a UTSW 3 116294750 critical splice donor site probably null
R4870:Cdc14a UTSW 3 116423460 missense probably benign 0.30
R4980:Cdc14a UTSW 3 116392857 nonsense probably null
R6228:Cdc14a UTSW 3 116351213 missense probably damaging 1.00
R6248:Cdc14a UTSW 3 116308194 missense probably benign 0.01
R6402:Cdc14a UTSW 3 116348459 missense probably damaging 1.00
R6749:Cdc14a UTSW 3 116297158 missense possibly damaging 0.68
R6852:Cdc14a UTSW 3 116328676 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAGAGGTGGTGTCTGTGAACTTAC -3'
(R):5'- ACGACCAGTCAGTGTTCAAGCC -3'

Sequencing Primer
(F):5'- ACTTACAGGTATAGAACGGCTC -3'
(R):5'- TCTAGGGAACTTGAACGCC -3'
Posted On2014-02-11