Incidental Mutation 'R1342:Bcl9'
ID156389
Institutional Source Beutler Lab
Gene Symbol Bcl9
Ensembl Gene ENSMUSG00000038256
Gene NameB cell CLL/lymphoma 9
Synonyms8030475K17Rik, A330041G23Rik, 2610202E01Rik
MMRRC Submission 039407-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R1342 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97203662-97297917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97205726 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1138 (Q1138K)
Ref Sequence ENSEMBL: ENSMUSP00000131692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046521] [ENSMUST00000166341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046521
AA Change: Q1138K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046152
Gene: ENSMUSG00000038256
AA Change: Q1138K

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 389 3.1e-24 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132266
Predicted Effect possibly damaging
Transcript: ENSMUST00000166341
AA Change: Q1138K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131692
Gene: ENSMUSG00000038256
AA Change: Q1138K

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 388 5.2e-22 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of 1q21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Bcl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bcl9 APN 3 97207202 missense probably damaging 1.00
IGL00817:Bcl9 APN 3 97205144 missense probably damaging 0.97
IGL01609:Bcl9 APN 3 97208975 missense probably benign 0.23
IGL02245:Bcl9 APN 3 97208693 missense probably damaging 1.00
IGL02385:Bcl9 APN 3 97209278 missense probably benign 0.01
IGL02534:Bcl9 APN 3 97215229 missense probably damaging 1.00
IGL02663:Bcl9 APN 3 97205332 missense probably damaging 1.00
IGL02705:Bcl9 APN 3 97204865 missense possibly damaging 0.94
IGL02884:Bcl9 APN 3 97210052 missense probably damaging 1.00
IGL03345:Bcl9 APN 3 97209192 missense probably benign
R0312:Bcl9 UTSW 3 97209411 missense probably benign 0.27
R0602:Bcl9 UTSW 3 97205786 missense probably benign 0.00
R0627:Bcl9 UTSW 3 97205473 missense probably damaging 1.00
R0644:Bcl9 UTSW 3 97210497 missense probably benign
R1836:Bcl9 UTSW 3 97205870 missense probably damaging 0.97
R1886:Bcl9 UTSW 3 97215397 missense probably benign 0.04
R1931:Bcl9 UTSW 3 97205144 missense probably damaging 0.97
R1972:Bcl9 UTSW 3 97207202 missense probably damaging 1.00
R1984:Bcl9 UTSW 3 97213734 missense probably damaging 0.98
R2119:Bcl9 UTSW 3 97208915 missense probably benign 0.04
R2924:Bcl9 UTSW 3 97209753 missense probably benign 0.00
R3081:Bcl9 UTSW 3 97205673 missense possibly damaging 0.82
R3851:Bcl9 UTSW 3 97209653 missense probably damaging 0.99
R4182:Bcl9 UTSW 3 97213683 critical splice donor site probably null
R4196:Bcl9 UTSW 3 97216368 utr 5 prime probably benign
R4209:Bcl9 UTSW 3 97209953 missense probably damaging 1.00
R5082:Bcl9 UTSW 3 97209902 missense probably damaging 0.97
R5440:Bcl9 UTSW 3 97210565 missense probably benign
R5770:Bcl9 UTSW 3 97215175 missense probably benign
R5863:Bcl9 UTSW 3 97210350 missense probably benign
R5891:Bcl9 UTSW 3 97208888 missense probably damaging 1.00
R6086:Bcl9 UTSW 3 97205524 missense possibly damaging 0.73
R6305:Bcl9 UTSW 3 97205938 missense possibly damaging 0.73
R6626:Bcl9 UTSW 3 97215396 missense probably benign 0.00
R7198:Bcl9 UTSW 3 97205195 missense possibly damaging 0.87
R7198:Bcl9 UTSW 3 97208867 missense probably damaging 0.99
R7548:Bcl9 UTSW 3 97205893 missense not run
X0011:Bcl9 UTSW 3 97205974 missense probably benign 0.05
Z1088:Bcl9 UTSW 3 97210641 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGGGCTTCTCCGATGGGATAATGC -3'
(R):5'- GGAATGACCCAGCCACTTTCTCAC -3'

Sequencing Primer
(F):5'- GATCAAACTCAGGTATTCCGGTG -3'
(R):5'- TCTCACTCCAATCAGATGCC -3'
Posted On2014-02-11