Incidental Mutation 'R1342:Ipo7'
ID156400
Institutional Source Beutler Lab
Gene Symbol Ipo7
Ensembl Gene ENSMUSG00000066232
Gene Nameimportin 7
SynonymsA330055O14Rik, Imp7, RanBP7
MMRRC Submission 039407-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1342 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110018274-110056609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110029804 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 94 (N94Y)
Ref Sequence ENSEMBL: ENSMUSP00000081782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084731
AA Change: N94Y

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: N94Y

DomainStartEndE-ValueType
IBN_N 22 101 3.06e-15 SMART
Pfam:Cse1 168 452 2.8e-12 PFAM
low complexity region 701 712 N/A INTRINSIC
low complexity region 881 900 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208821
Predicted Effect probably benign
Transcript: ENSMUST00000208951
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Ipo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ipo7 APN 7 110029848 intron probably benign
IGL02472:Ipo7 APN 7 110040853 missense probably damaging 1.00
IGL02502:Ipo7 APN 7 110051050 missense probably damaging 1.00
IGL02514:Ipo7 APN 7 110048828 missense possibly damaging 0.78
IGL02535:Ipo7 APN 7 110054026 missense probably damaging 0.98
IGL02961:Ipo7 APN 7 110047016 missense probably benign 0.02
R0089:Ipo7 UTSW 7 110050765 intron probably benign
R0355:Ipo7 UTSW 7 110049661 missense probably benign 0.00
R0565:Ipo7 UTSW 7 110049593 intron probably benign
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1791:Ipo7 UTSW 7 110027132 missense probably damaging 0.98
R1838:Ipo7 UTSW 7 110042109 missense probably damaging 1.00
R2116:Ipo7 UTSW 7 110051118 missense probably damaging 0.99
R2120:Ipo7 UTSW 7 110049631 missense probably damaging 1.00
R4366:Ipo7 UTSW 7 110029712 missense possibly damaging 0.58
R4366:Ipo7 UTSW 7 110048216 missense possibly damaging 0.88
R4805:Ipo7 UTSW 7 110051484 missense probably benign 0.16
R5228:Ipo7 UTSW 7 110046762 missense probably benign 0.00
R5903:Ipo7 UTSW 7 110050813 missense probably damaging 1.00
R5976:Ipo7 UTSW 7 110048807 missense probably damaging 1.00
R6254:Ipo7 UTSW 7 110049060 missense probably benign 0.00
R6335:Ipo7 UTSW 7 110018468 missense possibly damaging 0.92
R6360:Ipo7 UTSW 7 110027129 missense probably damaging 1.00
R6776:Ipo7 UTSW 7 110047065 missense probably damaging 0.98
R7132:Ipo7 UTSW 7 110054047 missense not run
X0062:Ipo7 UTSW 7 110052886 missense probably damaging 1.00
X0066:Ipo7 UTSW 7 110052734 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCAGTATGGTGGCTGGCAGAT -3'
(R):5'- GCACCTCTAAAATTAggtggcgca -3'

Sequencing Primer
(F):5'- cgcctgcctctacctcc -3'
(R):5'- tgggaggcagagacagg -3'
Posted On2014-02-11