Incidental Mutation 'R1342:Pdgfrb'
ID156418
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission 039407-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1342 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 61065880 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 370 (L370*)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect probably null
Transcript: ENSMUST00000025522
AA Change: L366*
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: L366*

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115274
AA Change: L370*
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: L370*

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Meta Mutation Damage Score 0.636 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCCTAAAGAAACCGTGCCC -3'
(R):5'- TGTGTCCATCACACAACAGGCTCTC -3'

Sequencing Primer
(F):5'- AGCCCCCAGAAGGTGTTTATC -3'
(R):5'- GGCTCTCAGACAAGAAGGTCC -3'
Posted On2014-02-11