Incidental Mutation 'R1343:Olfr667'
ID156434
Institutional Source Beutler Lab
Gene Symbol Olfr667
Ensembl Gene ENSMUSG00000056782
Gene Nameolfactory receptor 667
SynonymsGA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11
MMRRC Submission 039408-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R1343 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104914742-104921482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104916627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 223 (I223T)
Ref Sequence ENSEMBL: ENSMUSP00000150340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071362] [ENSMUST00000217177]
Predicted Effect probably damaging
Transcript: ENSMUST00000071362
AA Change: I223T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100470
Gene: ENSMUSG00000056782
AA Change: I223T

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 4.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.2e-8 PFAM
Pfam:7tm_1 43 295 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211111
Predicted Effect probably damaging
Transcript: ENSMUST00000217177
AA Change: I223T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 T C 5: 110,237,966 V361A probably damaging Het
Art1 A G 7: 102,106,953 Y117C probably damaging Het
Cecr2 T C 6: 120,754,711 Y215H probably damaging Het
Col6a3 T C 1: 90,768,347 E2666G unknown Het
Cps1 T A 1: 67,209,609 V1165E probably damaging Het
Gm11397 G A 13: 33,404,485 C351Y possibly damaging Het
Gpr65 A T 12: 98,275,629 K180N probably benign Het
Gsto2 A T 19: 47,884,707 probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Kif19a A G 11: 114,785,827 D494G probably benign Het
Lnx1 T C 5: 74,597,379 R695G probably damaging Het
Lonp1 A G 17: 56,620,272 L327P probably damaging Het
Nat8 T C 6: 85,830,621 T177A probably damaging Het
Nek1 T A 8: 61,028,675 M208K probably damaging Het
Obsl1 G T 1: 75,492,579 H1239Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Prmt3 C T 7: 49,818,108 S354L probably benign Het
Ralgapa1 T A 12: 55,707,978 H1176L probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Strc T C 2: 121,365,115 S1618G probably benign Het
Syne2 T C 12: 76,033,643 S4784P probably damaging Het
Usp14 T C 18: 10,016,623 T73A probably benign Het
Vmn2r53 G A 7: 12,584,774 P458L probably benign Het
Zfp292 T C 4: 34,805,238 D2602G probably damaging Het
Other mutations in Olfr667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Olfr667 APN 7 104916652 missense probably damaging 1.00
R0457:Olfr667 UTSW 7 104916973 missense probably benign 0.19
R0684:Olfr667 UTSW 7 104916634 missense probably benign 0.21
R1401:Olfr667 UTSW 7 104916756 missense probably damaging 1.00
R1415:Olfr667 UTSW 7 104916336 missense probably benign 0.03
R1644:Olfr667 UTSW 7 104916808 missense probably benign 0.02
R1907:Olfr667 UTSW 7 104917065 missense probably damaging 0.99
R2063:Olfr667 UTSW 7 104916775 missense probably benign 0.02
R3774:Olfr667 UTSW 7 104916906 missense probably benign 0.01
R4751:Olfr667 UTSW 7 104916410 nonsense probably null
R4958:Olfr667 UTSW 7 104916461 missense probably damaging 0.97
R4960:Olfr667 UTSW 7 104916708 missense probably benign 0.02
R5362:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R5988:Olfr667 UTSW 7 104916918 missense probably damaging 0.98
Z1088:Olfr667 UTSW 7 104916666 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGACACAACTAGATGAGCTGACACC -3'
(R):5'- TGACCAACCCTGTGATTGCCAAAG -3'

Sequencing Primer
(F):5'- CAGATAGAGGTTTGCCACTATGATG -3'
(R):5'- GATTGCCAAAGCTAGTCTTGC -3'
Posted On2014-02-11