Incidental Mutation 'R1343:Slc35e1'
ID156436
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission 039408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1343 (G1)
Quality Score111
Status Not validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 72492571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141352
SMART Domains Protein: ENSMUSP00000122215
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:EamA 5 58 1.5e-6 PFAM
Pfam:UAA 6 214 4e-8 PFAM
Pfam:TPT 67 211 1.7e-38 PFAM
Pfam:EamA 76 211 1.4e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152080
AA Change: T6A
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: T6A

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212699
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 T C 5: 110,237,966 V361A probably damaging Het
Art1 A G 7: 102,106,953 Y117C probably damaging Het
Cecr2 T C 6: 120,754,711 Y215H probably damaging Het
Col6a3 T C 1: 90,768,347 E2666G unknown Het
Cps1 T A 1: 67,209,609 V1165E probably damaging Het
Gm11397 G A 13: 33,404,485 C351Y possibly damaging Het
Gpr65 A T 12: 98,275,629 K180N probably benign Het
Gsto2 A T 19: 47,884,707 probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Kif19a A G 11: 114,785,827 D494G probably benign Het
Lnx1 T C 5: 74,597,379 R695G probably damaging Het
Lonp1 A G 17: 56,620,272 L327P probably damaging Het
Nat8 T C 6: 85,830,621 T177A probably damaging Het
Nek1 T A 8: 61,028,675 M208K probably damaging Het
Obsl1 G T 1: 75,492,579 H1239Q probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Prmt3 C T 7: 49,818,108 S354L probably benign Het
Ralgapa1 T A 12: 55,707,978 H1176L probably damaging Het
Strc T C 2: 121,365,115 S1618G probably benign Het
Syne2 T C 12: 76,033,643 S4784P probably damaging Het
Usp14 T C 18: 10,016,623 T73A probably benign Het
Vmn2r53 G A 7: 12,584,774 P458L probably benign Het
Zfp292 T C 4: 34,805,238 D2602G probably damaging Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0566:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1051:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1245:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1430:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
R7309:Slc35e1 UTSW 8 72492514 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCGCTCAAAATCACCTTGTTGACC -3'
(R):5'- AGGGGAAATTGACACCTACCGCAC -3'

Sequencing Primer
(F):5'- AAATCACCTTGTTGACCACGTTAC -3'
(R):5'- GCGTAGTCCAGAGGATTTACC -3'
Posted On2014-02-11