Incidental Mutation 'R1345:Rbm44'
ID156446
Institutional Source Beutler Lab
Gene Symbol Rbm44
Ensembl Gene ENSMUSG00000070732
Gene NameRNA binding motif protein 44
SynonymsLOC329207
MMRRC Submission 039410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91145089-91170795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91152759 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 223 (N223S)
Ref Sequence ENSEMBL: ENSMUSP00000092286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094698] [ENSMUST00000188818]
Predicted Effect probably damaging
Transcript: ENSMUST00000094698
AA Change: N223S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092286
Gene: ENSMUSG00000070732
AA Change: N223S

DomainStartEndE-ValueType
low complexity region 227 238 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
RRM 793 861 8.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188818
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Male mice homozygous or heterozygous for a knock-out allele exhibit enhanced fertility with increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Brf1 A T 12: 112,961,108 probably null Het
Cd86 A G 16: 36,618,324 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Olfr813 T C 10: 129,856,890 I124T probably damaging Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn1r170 C T 7: 23,606,362 T63I probably benign Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp7 T C 15: 76,890,708 S317P probably damaging Het
Other mutations in Rbm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rbm44 APN 1 91157109 missense probably benign
IGL01089:Rbm44 APN 1 91168697 missense possibly damaging 0.61
IGL01339:Rbm44 APN 1 91168964 missense probably benign 0.45
IGL01410:Rbm44 APN 1 91168829 missense probably benign 0.01
IGL01624:Rbm44 APN 1 91156658 missense probably damaging 0.96
IGL01963:Rbm44 APN 1 91163108 missense probably benign 0.00
IGL02067:Rbm44 APN 1 91152845 missense probably damaging 0.98
IGL02513:Rbm44 APN 1 91155538 missense possibly damaging 0.63
IGL02804:Rbm44 APN 1 91150176 intron probably benign
IGL02806:Rbm44 APN 1 91153077 missense possibly damaging 0.79
IGL02887:Rbm44 APN 1 91153180 missense probably damaging 1.00
IGL03309:Rbm44 APN 1 91168840 critical splice donor site probably null
R0360:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0364:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0647:Rbm44 UTSW 1 91156928 missense probably benign 0.00
R1352:Rbm44 UTSW 1 91153042 missense probably damaging 1.00
R1575:Rbm44 UTSW 1 91156843 splice site probably null
R1768:Rbm44 UTSW 1 91153957 splice site probably null
R4901:Rbm44 UTSW 1 91153328 missense probably benign 0.13
R4913:Rbm44 UTSW 1 91155494 missense probably damaging 1.00
R5023:Rbm44 UTSW 1 91169098 critical splice donor site probably null
R5569:Rbm44 UTSW 1 91168738 missense probably damaging 0.99
R5874:Rbm44 UTSW 1 91156840 critical splice donor site probably null
R5981:Rbm44 UTSW 1 91152689 missense possibly damaging 0.61
R6441:Rbm44 UTSW 1 91157077 missense probably damaging 0.98
R6515:Rbm44 UTSW 1 91165138 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGACAAAGAGAACAGCATTGTTGACC -3'
(R):5'- AGAGCTGCTTCTCTGTAAAATGCCATC -3'

Sequencing Primer
(F):5'- CTCCCAGTCAAGTGAGTTTGAAG -3'
(R):5'- CTCTGTAAAATGCCATCAAATGC -3'
Posted On2014-02-11