Incidental Mutation 'R1345:Vmn1r170'
ID156459
Institutional Source Beutler Lab
Gene Symbol Vmn1r170
Ensembl Gene ENSMUSG00000094187
Gene Namevomeronasal 1 receptor 170
SynonymsGm5999
MMRRC Submission 039410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23606175-23607089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23606362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 63 (T63I)
Ref Sequence ENSEMBL: ENSMUSP00000127655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170166]
Predicted Effect probably benign
Transcript: ENSMUST00000170166
AA Change: T63I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127655
Gene: ENSMUSG00000094187
AA Change: T63I

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 1.8e-13 PFAM
Pfam:7tm_1 30 287 3.6e-6 PFAM
Pfam:V1R 42 295 1.4e-20 PFAM
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Brf1 A T 12: 112,961,108 probably null Het
Cd86 A G 16: 36,618,324 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Olfr813 T C 10: 129,856,890 I124T probably damaging Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Rbm44 A G 1: 91,152,759 N223S probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp7 T C 15: 76,890,708 S317P probably damaging Het
Other mutations in Vmn1r170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Vmn1r170 APN 7 23606913 missense probably damaging 1.00
IGL02150:Vmn1r170 APN 7 23607040 nonsense probably null
IGL02216:Vmn1r170 APN 7 23606490 missense probably damaging 1.00
IGL02749:Vmn1r170 APN 7 23606291 missense probably benign 0.00
IGL02807:Vmn1r170 APN 7 23606335 missense probably damaging 1.00
IGL02828:Vmn1r170 APN 7 23606518 missense probably damaging 0.99
IGL02971:Vmn1r170 APN 7 23606334 missense possibly damaging 0.81
IGL03073:Vmn1r170 APN 7 23606848 missense probably damaging 1.00
IGL03151:Vmn1r170 APN 7 23606577 missense probably benign 0.35
R0079:Vmn1r170 UTSW 7 23606310 missense possibly damaging 0.95
R0266:Vmn1r170 UTSW 7 23606481 missense probably benign 0.00
R0980:Vmn1r170 UTSW 7 23606334 missense possibly damaging 0.81
R1620:Vmn1r170 UTSW 7 23606329 missense probably benign 0.30
R1713:Vmn1r170 UTSW 7 23606863 missense probably benign 0.30
R1745:Vmn1r170 UTSW 7 23606334 missense probably damaging 0.98
R1974:Vmn1r170 UTSW 7 23606481 missense probably benign 0.00
R2163:Vmn1r170 UTSW 7 23607037 missense probably damaging 1.00
R3812:Vmn1r170 UTSW 7 23606292 missense probably damaging 1.00
R4583:Vmn1r170 UTSW 7 23606662 missense probably benign 0.25
R5309:Vmn1r170 UTSW 7 23606455 missense probably damaging 0.97
R5378:Vmn1r170 UTSW 7 23606538 missense probably benign 0.00
R5379:Vmn1r170 UTSW 7 23606629 missense possibly damaging 0.81
R5661:Vmn1r170 UTSW 7 23606806 missense possibly damaging 0.82
R5673:Vmn1r170 UTSW 7 23606205 missense possibly damaging 0.58
R6181:Vmn1r170 UTSW 7 23606267 missense probably damaging 0.98
R6192:Vmn1r170 UTSW 7 23606509 missense probably damaging 1.00
X0060:Vmn1r170 UTSW 7 23606943 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ACCACAGAGGAAGTGGCTCTTCAG -3'
(R):5'- GAACACTGCATCATGGGCAAATGAC -3'

Sequencing Primer
(F):5'- GAAGTGGCTCTTCAGGTCCTC -3'
(R):5'- TGCCTATACTGAAACCAGTGGTG -3'
Posted On2014-02-11