Incidental Mutation 'R1345:Alx1'
ID156467
Institutional Source Beutler Lab
Gene Symbol Alx1
Ensembl Gene ENSMUSG00000036602
Gene NameALX homeobox 1
SynonymsCart1
MMRRC Submission 039410-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location102998707-103030215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103028492 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 39 (S39P)
Ref Sequence ENSEMBL: ENSMUSP00000152017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040859] [ENSMUST00000167156] [ENSMUST00000217946] [ENSMUST00000218282] [ENSMUST00000218681] [ENSMUST00000219194]
Predicted Effect probably benign
Transcript: ENSMUST00000040859
AA Change: S39P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042512
Gene: ENSMUSG00000036602
AA Change: S39P

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 301 321 7.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167156
AA Change: S39P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129230
Gene: ENSMUSG00000036602
AA Change: S39P

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 302 320 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170026
Predicted Effect possibly damaging
Transcript: ENSMUST00000217946
AA Change: S39P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000218282
AA Change: S39P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218508
Predicted Effect probably benign
Transcript: ENSMUST00000218681
AA Change: S39P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000219194
AA Change: S39P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has yet to be determined in humans; however, in rodents, it is necessary for survival of the forebrain mesenchyme and may also be involved in development of the cervix. Mutations in the mouse gene lead to neural tube defects such as acrania and meroanencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality with acrania and meroanencephaly, but the neural tube closure defect can be ameliorated with prenatal folic acid treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Brf1 A T 12: 112,961,108 probably null Het
Cd86 A G 16: 36,618,324 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Olfr813 T C 10: 129,856,890 I124T probably damaging Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Rbm44 A G 1: 91,152,759 N223S probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn1r170 C T 7: 23,606,362 T63I probably benign Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp7 T C 15: 76,890,708 S317P probably damaging Het
Other mutations in Alx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Alx1 APN 10 103022299 missense possibly damaging 0.93
IGL02508:Alx1 APN 10 103022193 missense probably damaging 0.99
IGL03079:Alx1 APN 10 103009348 missense probably damaging 1.00
R1370:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1846:Alx1 UTSW 10 103025304 missense possibly damaging 0.88
R1912:Alx1 UTSW 10 103025361 missense probably damaging 1.00
R4649:Alx1 UTSW 10 103009332 missense probably damaging 0.99
R4767:Alx1 UTSW 10 103025186 nonsense probably null
R5484:Alx1 UTSW 10 103025316 missense probably damaging 0.99
R5979:Alx1 UTSW 10 103022259 missense probably damaging 1.00
R6115:Alx1 UTSW 10 103028443 missense possibly damaging 0.78
R6919:Alx1 UTSW 10 103025200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCGGTGGTGCGGTATTTTAAC -3'
(R):5'- TGCAGCCGGGACGTATTAAGAGTCTG -3'

Sequencing Primer
(F):5'- AATCCGGCAGGATTTAGCTC -3'
(R):5'- ACGTATTAAGAGTCTGGGAGCTG -3'
Posted On2014-02-11