Incidental Mutation 'R1345:Brf1'
ID156471
Institutional Source Beutler Lab
Gene Symbol Brf1
Ensembl Gene ENSMUSG00000011158
Gene NameBRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
SynonymsGTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C
MMRRC Submission 039410-MU
Accession Numbers

Genbank: NM_028193; MGI: 1919558

Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112960085-113000704 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 112961108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011302]
Predicted Effect probably null
Transcript: ENSMUST00000011302
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221754
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Cd86 A G 16: 36,618,324 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Olfr813 T C 10: 129,856,890 I124T probably damaging Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Rbm44 A G 1: 91,152,759 N223S probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn1r170 C T 7: 23,606,362 T63I probably benign Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp7 T C 15: 76,890,708 S317P probably damaging Het
Other mutations in Brf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Brf1 APN 12 112963600 splice site probably benign
IGL01609:Brf1 APN 12 112963591 missense probably damaging 1.00
IGL01610:Brf1 APN 12 112988083 missense probably benign
IGL01622:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01623:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01791:Brf1 APN 12 112962475 missense probably benign 0.00
IGL02037:Brf1 APN 12 112993062 critical splice donor site probably null
IGL02227:Brf1 APN 12 112961774 missense probably damaging 1.00
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0138:Brf1 UTSW 12 112961139 missense probably damaging 0.99
R1370:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1927:Brf1 UTSW 12 113000344 missense possibly damaging 0.95
R2423:Brf1 UTSW 12 113000199 missense probably benign 0.17
R3608:Brf1 UTSW 12 112961274 missense probably benign 0.00
R3703:Brf1 UTSW 12 112969371 splice site probably null
R4033:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R4817:Brf1 UTSW 12 112972301 missense probably damaging 0.99
R4897:Brf1 UTSW 12 112965887 missense probably benign 0.05
R4985:Brf1 UTSW 12 112969370 splice site probably null
R5092:Brf1 UTSW 12 112979732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCATTGCTCTGTGAGCTG -3'
(R):5'- TTAGAGTCAGGAGGATTGCCACCC -3'

Sequencing Primer
(F):5'- gttaagagcactgactaatcttcc -3'
(R):5'- AGGATTGCCACCCTCTGC -3'
Posted On2014-02-11