Incidental Mutation 'R1345:Zfp7'
ID156477
Institutional Source Beutler Lab
Gene Symbol Zfp7
Ensembl Gene ENSMUSG00000033669
Gene Namezinc finger protein 7
SynonymsKRAB20, Zfp-7, Zfp86-rs1, Zfp65, Zfp80, KRAB7, Krox-2, mszf73-2
MMRRC Submission 039410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76879259-76892395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76890708 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 317 (S317P)
Ref Sequence ENSEMBL: ENSMUSP00000155599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023179] [ENSMUST00000229831] [ENSMUST00000229990] [ENSMUST00000230106] [ENSMUST00000230214]
Predicted Effect probably damaging
Transcript: ENSMUST00000023179
AA Change: S317P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023179
Gene: ENSMUSG00000033669
AA Change: S317P

DomainStartEndE-ValueType
KRAB 4 65 3.07e-33 SMART
ZnF_C2H2 192 214 6.88e-4 SMART
ZnF_C2H2 220 242 4.24e-4 SMART
ZnF_C2H2 248 270 2.09e-3 SMART
ZnF_C2H2 276 298 1.45e-2 SMART
ZnF_C2H2 304 326 1.13e-4 SMART
ZnF_C2H2 332 354 9.08e-4 SMART
ZnF_C2H2 360 383 2.24e-3 SMART
ZnF_C2H2 412 434 9.08e-4 SMART
ZnF_C2H2 440 462 1.67e-2 SMART
ZnF_C2H2 468 490 3.44e-4 SMART
ZnF_C2H2 496 518 8.47e-4 SMART
ZnF_C2H2 524 546 4.54e-4 SMART
ZnF_C2H2 552 574 7.9e-4 SMART
ZnF_C2H2 580 602 1.72e-4 SMART
ZnF_C2H2 633 655 1.98e-4 SMART
ZnF_C2H2 661 683 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229782
Predicted Effect probably benign
Transcript: ENSMUST00000229831
Predicted Effect probably benign
Transcript: ENSMUST00000229990
Predicted Effect probably damaging
Transcript: ENSMUST00000230106
AA Change: S317P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230954
Meta Mutation Damage Score 0.0432 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Brf1 A T 12: 112,961,108 probably null Het
Cd86 A G 16: 36,618,324 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Olfr813 T C 10: 129,856,890 I124T probably damaging Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Rbm44 A G 1: 91,152,759 N223S probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn1r170 C T 7: 23,606,362 T63I probably benign Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Zfp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp7 APN 15 76890901 intron probably benign
IGL01509:Zfp7 APN 15 76881133 missense probably damaging 1.00
IGL01694:Zfp7 APN 15 76890795 nonsense probably null
IGL01731:Zfp7 APN 15 76888305 nonsense probably null
IGL02025:Zfp7 APN 15 76888264 missense probably damaging 1.00
R0841:Zfp7 UTSW 15 76891504 missense probably damaging 1.00
R1625:Zfp7 UTSW 15 76881174 missense probably damaging 1.00
R1872:Zfp7 UTSW 15 76891777 missense probably benign 0.00
R2330:Zfp7 UTSW 15 76891309 missense probably damaging 1.00
R4170:Zfp7 UTSW 15 76891618 missense probably benign 0.00
R4795:Zfp7 UTSW 15 76891346 nonsense probably null
R4796:Zfp7 UTSW 15 76891346 nonsense probably null
R5038:Zfp7 UTSW 15 76891810 missense probably benign 0.01
R5277:Zfp7 UTSW 15 76881203 missense probably damaging 1.00
R5285:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5287:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5445:Zfp7 UTSW 15 76890854 nonsense probably null
R5655:Zfp7 UTSW 15 76891429 missense probably damaging 1.00
R6320:Zfp7 UTSW 15 76890610 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGAGAGAACCGTTACCCATGTGAAG -3'
(R):5'- TAGAGTTGCTCTCTGGCAGAAGGC -3'

Sequencing Primer
(F):5'- atgtgaccagtgtgggaag -3'
(R):5'- GGCCTTGCCACACTCCTG -3'
Posted On2014-02-11