Incidental Mutation 'R1345:Cd86'
ID156478
Institutional Source Beutler Lab
Gene Symbol Cd86
Ensembl Gene ENSMUSG00000022901
Gene NameCD86 antigen
SynonymsB70, B7.2, Ly58, Cd28l2, Ly-58, MB7-2, B7-2
MMRRC Submission 039410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location36603869-36666081 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 36618324 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089620] [ENSMUST00000135280]
Predicted Effect probably null
Transcript: ENSMUST00000089620
SMART Domains Protein: ENSMUSP00000087047
Gene: ENSMUSG00000022901

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGv 35 112 1.76e-8 SMART
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 246 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135280
SMART Domains Protein: ENSMUSP00000117756
Gene: ENSMUSG00000022901

DomainStartEndE-ValueType
IGv 40 117 1.76e-8 SMART
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice on an NOD background display a phenotype similar to human Guillain-Barre Syndrome, exhibiting severe peripheral nervous system inflammation, sciatic nerve demyelination, elevated auto-antibodies to myelin protein zero, hindlimb paralysis, and weak forelimb grip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Brf1 A T 12: 112,961,108 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Olfr813 T C 10: 129,856,890 I124T probably damaging Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Rbm44 A G 1: 91,152,759 N223S probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn1r170 C T 7: 23,606,362 T63I probably benign Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp7 T C 15: 76,890,708 S317P probably damaging Het
Other mutations in Cd86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Cd86 APN 16 36620953 missense probably benign 0.04
IGL01723:Cd86 APN 16 36607124 missense probably benign
IGL01834:Cd86 APN 16 36607119 missense probably benign 0.20
IGL02554:Cd86 APN 16 36618485 missense probably benign 0.01
IGL02714:Cd86 APN 16 36620928 missense possibly damaging 0.49
R0032:Cd86 UTSW 16 36620873 missense probably damaging 0.96
R0032:Cd86 UTSW 16 36620873 missense probably damaging 0.96
R0315:Cd86 UTSW 16 36620944 missense possibly damaging 0.88
R0494:Cd86 UTSW 16 36618637 splice site probably benign
R1459:Cd86 UTSW 16 36628988 missense probably benign 0.09
R1616:Cd86 UTSW 16 36628976 missense probably benign 0.00
R4436:Cd86 UTSW 16 36620832 missense probably benign 0.04
R4593:Cd86 UTSW 16 36606556 makesense probably null
R4612:Cd86 UTSW 16 36615330 missense probably benign 0.00
R6058:Cd86 UTSW 16 36629015 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGACTGGGTCAGTTTCAGGGCTAAG -3'
(R):5'- ACCTGCACGTCTAAGCAAGGTCAC -3'

Sequencing Primer
(F):5'- TCAGGGCTAAGACCATGTTTC -3'
(R):5'- GTCACCCGAAACCTAAGAAGATG -3'
Posted On2014-02-11