Mutagenetix > Incidental Mutations

Incidental Mutation 'R1345:Tedc2'

156481

Institutional Source

Beutler Lab

Gene Symbol

Tedc2

Ensembl Gene

ENSMUSG00000024118

Gene Name

tubulin epsilon and delta complex 2

Synonyms

1600002H07Rik

MMRRC Submission

039410-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.391) question?

Stock #

R1345 (G1)

Quality Score

123

Status

Validated

Chromosome

Chromosomal Location

24215054-24220851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24216317 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 366 (E366V)

Ref Sequence

ENSEMBL: ENSMUSP00000024930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024930]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024930
AA Change: E366V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118
AA Change: E366V

Domain	Start	End	E-Value	Type
low complexity region	32	49	N/A	INTRINSIC
low complexity region	78	84	N/A	INTRINSIC
low complexity region	111	131	N/A	INTRINSIC
Pfam:DUF4693	150	434	8.6e-145	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124557

SMART Domains

Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	16	32	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148704

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149916

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171563

Meta Mutation Damage Score

0.328

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 92.3%

Validation Efficiency

100% (45/45)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	C	T	12: 110,668,718	V129I	probably damaging	Het
Akr1c18	T	C	13: 4,145,214	T82A	possibly damaging	Het
Alx1	A	G	10: 103,028,492	S39P	possibly damaging	Het
Atr	A	G	9: 95,920,355	T1767A	probably benign	Het
Brf1	A	T	12: 112,961,108		probably null	Het
Cd86	A	G	16: 36,618,324		probably null	Het
Cdan1	A	G	2: 120,719,139		probably null	Het
Cntln	A	G	4: 84,973,991	D371G	probably damaging	Het
Cypt4	A	G	9: 24,625,219	T2A	possibly damaging	Het
Dll1	G	T	17: 15,373,555	Y183*	probably null	Het
Dnmt1	G	T	9: 20,908,518	P1444Q	probably damaging	Het
Ern2	A	G	7: 122,177,770	L309P	probably damaging	Het
Fam151a	A	G	4: 106,742,294	K142E	probably damaging	Het
Fbn1	T	C	2: 125,314,671	E2378G	probably damaging	Het
Gm9573	T	A	17: 35,621,597		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Kdm5b	A	C	1: 134,630,550	T1432P	possibly damaging	Het
Kif2a	G	A	13: 106,993,915	S15F	probably damaging	Het
Lzic	A	G	4: 149,486,851	E31G	probably damaging	Het
Mmp16	A	G	4: 18,112,021	M466V	probably benign	Het
Mtm1	T	C	X: 71,287,231	V203A	probably benign	Het
Neurl4	A	G	11: 69,903,876	M249V	probably benign	Het
Olfr813	T	C	10: 129,856,890	I124T	probably damaging	Het
Plxna2	T	C	1: 194,644,486	Y243H	probably damaging	Het
Rbm44	A	G	1: 91,152,759	N223S	probably damaging	Het
Sel1l3	G	T	5: 53,200,217	H144Q	possibly damaging	Het
Simc1	A	ANNNNNNNNNNNNNNNNNNNNN	13: 54,525,247		probably benign	Het
Snrpb2	A	G	2: 143,065,166		probably benign	Het
Spata31d1d	T	G	13: 59,726,024	K1232N	possibly damaging	Het
Spink5	A	T	18: 43,990,682	E345D	possibly damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Tarbp1	T	C	8: 126,448,330	D789G	probably benign	Het
Tmem232	T	C	17: 65,450,406	N264S	possibly damaging	Het
Trim43b	G	C	9: 89,085,672	L303V	possibly damaging	Het
Tulp2	C	A	7: 45,518,721	R298S	probably benign	Het
Usp42	A	G	5: 143,717,333	V511A	probably damaging	Het
Vav1	A	T	17: 57,301,214	T321S	probably benign	Het
Vmn1r169	A	C	7: 23,577,822	H213P	probably damaging	Het
Vmn1r170	C	T	7: 23,606,362	T63I	probably benign	Het
Vmn2r103	T	G	17: 19,794,247	W434G	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp7	T	C	15: 76,890,708	S317P	probably damaging	Het

Other mutations in Tedc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01963:Tedc2	APN	17	24217952	missense	probably benign	0.01
IGL02111:Tedc2	APN	17	24218166	splice site	probably benign
IGL02347:Tedc2	APN	17	24220610	missense	probably damaging	1.00
IGL03400:Tedc2	APN	17	24219803	missense	probably benign
R0766:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R0766:Tedc2	UTSW	17	24216318	nonsense	probably null
R1066:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1066:Tedc2	UTSW	17	24216318	nonsense	probably null
R1067:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1067:Tedc2	UTSW	17	24216318	nonsense	probably null
R1085:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1085:Tedc2	UTSW	17	24216318	nonsense	probably null
R1086:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1086:Tedc2	UTSW	17	24216318	nonsense	probably null
R1136:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1136:Tedc2	UTSW	17	24216318	nonsense	probably null
R1137:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1137:Tedc2	UTSW	17	24216318	nonsense	probably null
R1203:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1203:Tedc2	UTSW	17	24216318	nonsense	probably null
R1345:Tedc2	UTSW	17	24216318	nonsense	probably null
R1385:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1385:Tedc2	UTSW	17	24216318	nonsense	probably null
R1396:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1396:Tedc2	UTSW	17	24216318	nonsense	probably null
R1888:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1888:Tedc2	UTSW	17	24216318	nonsense	probably null
R1888:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1888:Tedc2	UTSW	17	24216318	nonsense	probably null
R1891:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1891:Tedc2	UTSW	17	24216318	nonsense	probably null
R1943:Tedc2	UTSW	17	24217949	missense	possibly damaging	0.90
R1984:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1984:Tedc2	UTSW	17	24216318	nonsense	probably null
R1985:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1985:Tedc2	UTSW	17	24216318	nonsense	probably null
R1986:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R1986:Tedc2	UTSW	17	24216318	nonsense	probably null
R2026:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R2026:Tedc2	UTSW	17	24216318	nonsense	probably null
R2054:Tedc2	UTSW	17	24216317	missense	probably damaging	1.00
R2054:Tedc2	UTSW	17	24216318	nonsense	probably null
R2086:Tedc2	UTSW	17	24217900	missense	probably damaging	1.00
R2317:Tedc2	UTSW	17	24216384	missense	probably benign	0.00
R3705:Tedc2	UTSW	17	24216387	missense	probably benign	0.30
R4085:Tedc2	UTSW	17	24219839	missense	probably benign	0.01
R4664:Tedc2	UTSW	17	24220140	splice site	probably benign
R4676:Tedc2	UTSW	17	24220011	missense	probably benign
R4686:Tedc2	UTSW	17	24217888	critical splice donor site	probably null
R4762:Tedc2	UTSW	17	24216380	missense	probably benign	0.05
R4837:Tedc2	UTSW	17	24220593	missense	probably damaging	1.00
R4863:Tedc2	UTSW	17	24217936	missense	probably damaging	1.00
R5936:Tedc2	UTSW	17	24216341	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTACTGCTTCTCCCGAGACTTAC -3'
(R):5'- TGCATACTACGGGCTGCTACACAC -3'

Sequencing Primer
(F):5'- TCCCGAGACTTACCCTGG -3'
(R):5'- ctgcctgcctctgcctc -3'

Posted On

2014-02-11