Mutagenetix > Incidental Mutation

Incidental Mutation 'R1348:Igf1r'

156561

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

IGF-1R, line 186, A330103N21Rik, hyft, CD221

MMRRC Submission

039413-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1348 (G1)

Quality Score

104

Status

Not validated

Chromosome

Chromosomal Location

67602575-67883416 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 67868216 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1220 (N1220K)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005671
AA Change: N1220K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: N1220K

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208871

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 94.2%
20x: 87.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	G	17: 24,593,212 (GRCm39)		probably null	Het
Art1	G	A	7: 101,756,579 (GRCm39)	A33T	possibly damaging	Het
Aspa	G	A	11: 73,215,309 (GRCm39)	T2I	probably damaging	Het
Cntn1	C	T	15: 92,212,544 (GRCm39)	T902I	probably damaging	Het
Dpep1	G	A	8: 123,925,899 (GRCm39)	C118Y	probably benign	Het
Garin1a	A	G	6: 29,283,284 (GRCm39)	H36R	probably benign	Het
Gucy2g	C	T	19: 55,211,338 (GRCm39)	V631I	possibly damaging	Het
Insr	A	T	8: 3,242,635 (GRCm39)	I28N	probably damaging	Het
Katnal2	T	C	18: 77,066,238 (GRCm39)		probably null	Het
Klrb1a	T	C	6: 128,586,797 (GRCm39)	D156G	possibly damaging	Het
Kpna6	G	A	4: 129,555,152 (GRCm39)	R26*	probably null	Het
Muc2	CGTG	CGTGTG	7: 141,699,185 (GRCm38)		probably null	Het
Naa15	C	G	3: 51,373,091 (GRCm39)	C661W	probably damaging	Het
Or10g7	T	C	9: 39,905,124 (GRCm39)	I6T	probably benign	Het
Or1e1	G	T	11: 73,244,682 (GRCm39)	M34I	probably benign	Het
Or8g20	A	G	9: 39,396,532 (GRCm39)	S3P	probably benign	Het
Paxbp1	A	G	16: 90,831,904 (GRCm39)	V328A	probably damaging	Het
Pkd1l1	T	C	11: 8,784,806 (GRCm39)	T1993A	probably benign	Het
Pold1	C	T	7: 44,184,106 (GRCm39)	V865I	probably benign	Het
Racgap1	A	G	15: 99,524,246 (GRCm39)	I387T	possibly damaging	Het
Rbm15	G	T	3: 107,239,946 (GRCm39)	R151S	possibly damaging	Het
Rbms2	C	T	10: 128,012,214 (GRCm39)		probably null	Het
Recql4	A	G	15: 76,593,411 (GRCm39)	I140T	probably benign	Het
Shld2	T	A	14: 33,990,880 (GRCm39)	I9F	probably damaging	Het
Sorl1	A	T	9: 41,911,708 (GRCm39)		probably null	Het
Speg	G	A	1: 75,399,516 (GRCm39)	G2321D	probably damaging	Het
Trp53tg5	A	G	2: 164,315,521 (GRCm39)		probably null	Het
Tyw3	A	C	3: 154,299,451 (GRCm39)	M86R	possibly damaging	Het
Vmn1r11	G	A	6: 57,114,963 (GRCm39)	C209Y	probably benign	Het
Zfp472	T	A	17: 33,196,794 (GRCm39)	F290I	probably benign	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	67,839,771 (GRCm39)	missense	probably benign
IGL00837:Igf1r	APN	7	67,851,100 (GRCm39)	splice site	probably benign
IGL01515:Igf1r	APN	7	67,857,200 (GRCm39)	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	67,843,189 (GRCm39)	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	67,839,706 (GRCm39)	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	67,843,144 (GRCm39)	missense	probably benign
IGL02672:Igf1r	APN	7	67,839,781 (GRCm39)	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	67,850,997 (GRCm39)	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	67,839,739 (GRCm39)	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	67,864,791 (GRCm39)	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	67,864,688 (GRCm39)	missense	probably damaging	1.00
Frufru	UTSW	7	67,653,911 (GRCm39)	missense	probably damaging	1.00
Hungarian	UTSW	7	67,864,745 (GRCm39)	missense	probably damaging	1.00
Mimi	UTSW	7	67,844,774 (GRCm39)	missense	possibly damaging	0.67
Piroshka	UTSW	7	67,857,084 (GRCm39)	nonsense	probably null
Romanian	UTSW	7	67,653,885 (GRCm39)	missense	possibly damaging	0.94
Sublime	UTSW	7	67,653,927 (GRCm39)	missense	probably damaging	1.00
Toy	UTSW	7	67,653,720 (GRCm39)	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	67,861,802 (GRCm39)	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	67,861,802 (GRCm39)	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	67,875,934 (GRCm39)	small insertion	probably benign
FR4737:Igf1r	UTSW	7	67,875,929 (GRCm39)	small insertion	probably benign
FR4976:Igf1r	UTSW	7	67,875,934 (GRCm39)	small insertion	probably benign
FR4976:Igf1r	UTSW	7	67,875,929 (GRCm39)	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	67,857,211 (GRCm39)	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	67,814,990 (GRCm39)	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	67,875,941 (GRCm39)	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	67,857,574 (GRCm39)	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	67,814,903 (GRCm39)	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	67,861,906 (GRCm39)	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	67,861,839 (GRCm39)	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	67,844,774 (GRCm39)	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	67,814,875 (GRCm39)	missense	probably benign	0.00
R1471:Igf1r	UTSW	7	67,653,585 (GRCm39)	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	67,857,617 (GRCm39)	missense	probably benign
R1745:Igf1r	UTSW	7	67,819,661 (GRCm39)	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	67,844,822 (GRCm39)	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	67,864,681 (GRCm39)	nonsense	probably null
R1823:Igf1r	UTSW	7	67,844,729 (GRCm39)	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	67,850,997 (GRCm39)	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	67,857,023 (GRCm39)	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	67,653,698 (GRCm39)	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	67,814,982 (GRCm39)	missense	probably benign
R2221:Igf1r	UTSW	7	67,851,710 (GRCm39)	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	67,861,828 (GRCm39)	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	67,861,828 (GRCm39)	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	67,861,828 (GRCm39)	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	67,833,147 (GRCm39)	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	67,839,810 (GRCm39)	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	67,844,826 (GRCm39)	nonsense	probably null
R4387:Igf1r	UTSW	7	67,819,757 (GRCm39)	missense	probably benign
R4388:Igf1r	UTSW	7	67,819,757 (GRCm39)	missense	probably benign
R4728:Igf1r	UTSW	7	67,839,372 (GRCm39)	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	67,814,947 (GRCm39)	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	67,857,067 (GRCm39)	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	67,843,166 (GRCm39)	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	67,843,107 (GRCm39)	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	67,833,258 (GRCm39)	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	67,857,569 (GRCm39)	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	67,857,001 (GRCm39)	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	67,839,781 (GRCm39)	missense	probably benign
R6189:Igf1r	UTSW	7	67,857,084 (GRCm39)	nonsense	probably null
R6262:Igf1r	UTSW	7	67,653,720 (GRCm39)	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	67,653,885 (GRCm39)	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	67,814,981 (GRCm39)	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	67,839,798 (GRCm39)	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	67,850,998 (GRCm39)	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	67,857,067 (GRCm39)	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	67,653,927 (GRCm39)	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	67,653,911 (GRCm39)	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	67,836,905 (GRCm39)	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	67,844,826 (GRCm39)	nonsense	probably null
R7442:Igf1r	UTSW	7	67,823,026 (GRCm39)	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	67,834,500 (GRCm39)	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	67,839,849 (GRCm39)	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	67,861,802 (GRCm39)	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	67,836,796 (GRCm39)	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	67,845,377 (GRCm39)	missense	probably benign
R8539:Igf1r	UTSW	7	67,653,596 (GRCm39)	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	67,819,802 (GRCm39)	splice site	probably benign
R8746:Igf1r	UTSW	7	67,864,745 (GRCm39)	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	67,875,769 (GRCm39)	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	67,875,769 (GRCm39)	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	67,833,211 (GRCm39)	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	67,833,186 (GRCm39)	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	67,861,775 (GRCm39)	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	67,844,746 (GRCm39)	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	67,857,001 (GRCm39)	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	67,864,682 (GRCm39)	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	67,857,554 (GRCm39)	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	67,839,423 (GRCm39)	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	67,654,065 (GRCm39)	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	67,875,927 (GRCm39)	small insertion	probably benign
RF032:Igf1r	UTSW	7	67,875,927 (GRCm39)	small insertion	probably benign
RF034:Igf1r	UTSW	7	67,875,924 (GRCm39)	small insertion	probably benign
RF037:Igf1r	UTSW	7	67,875,924 (GRCm39)	small insertion	probably benign
RF039:Igf1r	UTSW	7	67,875,924 (GRCm39)	small insertion	probably benign
RF044:Igf1r	UTSW	7	67,875,927 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,916 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,930 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,928 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,922 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,917 (GRCm39)	small insertion	probably benign
Z1191:Igf1r	UTSW	7	67,875,918 (GRCm39)	small insertion	probably benign
Z1191:Igf1r	UTSW	7	67,875,917 (GRCm39)	small insertion	probably benign
Z1191:Igf1r	UTSW	7	67,875,921 (GRCm39)	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CACAAAGTGCAGTCGTCACATTGAG -3'
(R):5'- GCAAAGTGCCAATTAGCACTGGGG -3'

Sequencing Primer
(F):5'- GAGGACACTTTTTTTCAGGACC -3'
(R):5'- CAATTAGCACTGGGGGGACC -3'

Posted On

2014-02-11