Incidental Mutation 'R1348:Zfp472'
ID156583
Institutional Source Beutler Lab
Gene Symbol Zfp472
Ensembl Gene ENSMUSG00000053600
Gene Namezinc finger protein 472
SynonymsKrim-1, Krim-1A, Krim-1B
MMRRC Submission 039413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1348 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32965814-32979233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32977820 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 290 (F290I)
Ref Sequence ENSEMBL: ENSMUSP00000036514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039132]
Predicted Effect probably benign
Transcript: ENSMUST00000039132
AA Change: F290I

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036514
Gene: ENSMUSG00000053600
AA Change: F290I

DomainStartEndE-ValueType
KRAB 10 62 4.36e-15 SMART
ZnF_C2H2 197 219 2.45e0 SMART
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.76e-1 SMART
ZnF_C2H2 281 303 3.58e-2 SMART
ZnF_C2H2 309 331 3.29e-1 SMART
ZnF_C2H2 337 359 6.08e0 SMART
ZnF_C2H2 365 387 2.32e-1 SMART
ZnF_C2H2 393 415 6.57e-1 SMART
ZnF_C2H2 421 443 1.5e-4 SMART
ZnF_C2H2 449 471 2.2e-2 SMART
ZnF_C2H2 477 499 1.01e-1 SMART
ZnF_C2H2 505 527 8.94e-3 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,374,238 probably null Het
Art1 G A 7: 102,107,372 A33T possibly damaging Het
Aspa G A 11: 73,324,483 T2I probably damaging Het
Cntn1 C T 15: 92,314,663 T902I probably damaging Het
Dpep1 G A 8: 123,199,160 C118Y probably benign Het
Fam35a T A 14: 34,268,923 I9F probably damaging Het
Fam71f2 A G 6: 29,283,285 H36R probably benign Het
Gucy2g C T 19: 55,222,906 V631I possibly damaging Het
Igf1r C G 7: 68,218,468 N1220K probably damaging Het
Insr A T 8: 3,192,635 I28N probably damaging Het
Katnal2 T C 18: 76,978,542 probably null Het
Klrb1a T C 6: 128,609,834 D156G possibly damaging Het
Kpna6 G A 4: 129,661,359 R26* probably null Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Naa15 C G 3: 51,465,670 C661W probably damaging Het
Olfr20 G T 11: 73,353,856 M34I probably benign Het
Olfr44 A G 9: 39,485,236 S3P probably benign Het
Olfr978 T C 9: 39,993,828 I6T probably benign Het
Paxbp1 A G 16: 91,035,016 V328A probably damaging Het
Pkd1l1 T C 11: 8,834,806 T1993A probably benign Het
Pold1 C T 7: 44,534,682 V865I probably benign Het
Racgap1 A G 15: 99,626,365 I387T possibly damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rbms2 C T 10: 128,176,345 probably null Het
Recql4 A G 15: 76,709,211 I140T probably benign Het
Sorl1 A T 9: 42,000,412 probably null Het
Speg G A 1: 75,422,872 G2321D probably damaging Het
Trp53tg5 A G 2: 164,473,601 probably null Het
Tyw3 A C 3: 154,593,814 M86R possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Other mutations in Zfp472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp472 APN 17 32977524 missense possibly damaging 0.47
IGL03012:Zfp472 APN 17 32977571 missense probably benign 0.18
IGL03184:Zfp472 APN 17 32977416 nonsense probably null
IGL03223:Zfp472 APN 17 32977274 missense probably benign 0.03
R0421:Zfp472 UTSW 17 32975923 missense possibly damaging 0.71
R0463:Zfp472 UTSW 17 32975962 missense probably damaging 0.98
R0614:Zfp472 UTSW 17 32977934 missense possibly damaging 0.53
R1557:Zfp472 UTSW 17 32975926 missense probably benign 0.32
R1630:Zfp472 UTSW 17 32977978 nonsense probably null
R1725:Zfp472 UTSW 17 32977337 missense possibly damaging 0.53
R1856:Zfp472 UTSW 17 32965913 missense possibly damaging 0.53
R1964:Zfp472 UTSW 17 32977874 missense possibly damaging 0.79
R2115:Zfp472 UTSW 17 32978014 missense possibly damaging 0.73
R2249:Zfp472 UTSW 17 32978135 missense possibly damaging 0.87
R2252:Zfp472 UTSW 17 32976283 nonsense probably null
R3709:Zfp472 UTSW 17 32977711 nonsense probably null
R4119:Zfp472 UTSW 17 32978215 nonsense probably null
R4406:Zfp472 UTSW 17 32978160 missense probably benign 0.01
R4485:Zfp472 UTSW 17 32977568 missense possibly damaging 0.96
R4650:Zfp472 UTSW 17 32977657 missense possibly damaging 0.86
R4820:Zfp472 UTSW 17 32977442 missense probably benign 0.01
R5369:Zfp472 UTSW 17 32977743 missense probably damaging 0.98
R5438:Zfp472 UTSW 17 32978219 missense probably damaging 0.96
R5529:Zfp472 UTSW 17 32978433 missense possibly damaging 0.92
R5950:Zfp472 UTSW 17 32977507 missense possibly damaging 0.53
R6158:Zfp472 UTSW 17 32978389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCGTCCCTCACAGCTTCACA -3'
(R):5'- AGACATTCCCATGATTTAGAGTGCGAGA -3'

Sequencing Primer
(F):5'- CAAACATGAAAGGATTCACACTGG -3'
(R):5'- gatttcccacactgcttacatac -3'
Posted On2014-02-11