Incidental Mutation 'R1351:Car9'
ID156642
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Namecarbonic anhydrase 9
SynonymsCAIX, MN/CA9
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43506966-43513729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 A G 3: 62,380,841 E444G probably damaging Het
Astl G A 2: 127,347,185 V144M possibly damaging Het
AW146154 A T 7: 41,480,454 C413S probably damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Defb26 A T 2: 152,507,817 M181K unknown Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Hif1a T C 12: 73,940,461 S443P probably benign Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Rrp1b A G 17: 32,056,637 H386R possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zfyve28 T G 5: 34,232,205 D217A probably damaging Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43512941 splice site probably benign
IGL01893:Car9 APN 4 43510252 missense probably damaging 1.00
IGL02064:Car9 APN 4 43507363 missense probably benign
R0122:Car9 UTSW 4 43512206 missense probably benign 0.05
R0314:Car9 UTSW 4 43509212 critical splice donor site probably null
R0497:Car9 UTSW 4 43511881 missense probably damaging 1.00
R1018:Car9 UTSW 4 43512439 critical splice donor site probably null
R1132:Car9 UTSW 4 43512439 critical splice donor site probably null
R1218:Car9 UTSW 4 43512439 critical splice donor site probably null
R1219:Car9 UTSW 4 43512439 critical splice donor site probably null
R1222:Car9 UTSW 4 43512439 critical splice donor site probably null
R1350:Car9 UTSW 4 43512439 critical splice donor site probably null
R1352:Car9 UTSW 4 43512439 critical splice donor site probably null
R1353:Car9 UTSW 4 43512439 critical splice donor site probably null
R1389:Car9 UTSW 4 43512439 critical splice donor site probably null
R1417:Car9 UTSW 4 43512439 critical splice donor site probably null
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1573:Car9 UTSW 4 43512439 critical splice donor site probably null
R1818:Car9 UTSW 4 43512439 critical splice donor site probably null
R1819:Car9 UTSW 4 43512439 critical splice donor site probably null
R4033:Car9 UTSW 4 43508624 missense possibly damaging 0.52
R4597:Car9 UTSW 4 43509138 missense probably damaging 1.00
R4609:Car9 UTSW 4 43507267 missense possibly damaging 0.81
R4719:Car9 UTSW 4 43508616 nonsense probably null
R5402:Car9 UTSW 4 43510213 missense probably damaging 1.00
R5624:Car9 UTSW 4 43509146 missense probably benign 0.03
R6471:Car9 UTSW 4 43511938 missense probably damaging 1.00
R6850:Car9 UTSW 4 43507321 missense probably damaging 0.96
X0067:Car9 UTSW 4 43507198 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On2014-02-11