Incidental Mutation 'R1352:Car9'
ID 156694
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 039417-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1352 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
AlphaFold Q8VHB5
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,784,892 (GRCm39) probably benign Het
Acbd3 T A 1: 180,566,095 (GRCm39) Y263N probably damaging Het
Aldh4a1 T C 4: 139,362,830 (GRCm39) V142A probably benign Het
Cass4 T C 2: 172,258,415 (GRCm39) S138P probably damaging Het
Cbln4 T C 2: 171,879,376 (GRCm39) K171E possibly damaging Het
Cd226 A G 18: 89,265,298 (GRCm39) Y79C probably damaging Het
Dclre1a T C 19: 56,533,595 (GRCm39) D333G probably damaging Het
Dst T A 1: 34,268,329 (GRCm39) probably null Het
Eml5 A G 12: 98,797,262 (GRCm39) probably benign Het
Evx1 T C 6: 52,293,995 (GRCm39) S388P probably damaging Het
Gins1 T A 2: 150,772,768 (GRCm39) L177* probably null Het
Gm5422 A C 10: 31,126,731 (GRCm39) noncoding transcript Het
Gmppa T A 1: 75,417,178 (GRCm39) D204E probably benign Het
Ifna7 A C 4: 88,734,897 (GRCm39) T145P possibly damaging Het
Inhbb T C 1: 119,348,425 (GRCm39) D131G probably benign Het
Itpr2 T C 6: 146,013,240 (GRCm39) K2679E probably damaging Het
Kif20b C A 19: 34,902,035 (GRCm39) H4N probably benign Het
Kng1 G T 16: 22,886,444 (GRCm39) probably null Het
Lrrfip1 C T 1: 91,043,089 (GRCm39) A498V probably benign Het
Myo3a T A 2: 22,328,486 (GRCm39) probably null Het
Nkapl T C 13: 21,652,230 (GRCm39) R128G unknown Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5bw2 A T 7: 6,573,782 (GRCm39) Y264F probably benign Het
Prlr T C 15: 10,328,872 (GRCm39) V449A probably benign Het
Rbm44 C A 1: 91,080,764 (GRCm39) D317E probably damaging Het
Sirt5 T C 13: 43,548,283 (GRCm39) S310P probably damaging Het
Spice1 T C 16: 44,207,185 (GRCm39) S856P probably damaging Het
Sptan1 T A 2: 29,911,199 (GRCm39) probably benign Het
St6gal1 A G 16: 23,140,401 (GRCm39) K191E probably damaging Het
Stat6 A T 10: 127,486,680 (GRCm39) Q152L probably benign Het
Stk3 T C 15: 35,008,371 (GRCm39) D253G probably damaging Het
Tas2r139 C T 6: 42,117,874 (GRCm39) A2V probably benign Het
Tfpi2 A G 6: 3,968,281 (GRCm39) L15P probably damaging Het
Topbp1 T A 9: 103,224,207 (GRCm39) C1445S probably benign Het
Trappc11 A T 8: 47,978,081 (GRCm39) H195Q possibly damaging Het
Ttc21a A T 9: 119,783,718 (GRCm39) E600V possibly damaging Het
Ttn T C 2: 76,677,041 (GRCm39) probably benign Het
Vmn2r88 T C 14: 51,656,007 (GRCm39) S740P probably damaging Het
Wrn A C 8: 33,784,944 (GRCm39) V476G probably benign Het
Zdbf2 C A 1: 63,342,212 (GRCm39) A197E probably damaging Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0314:Car9 UTSW 4 43,509,212 (GRCm39) critical splice donor site probably null
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1132:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1350:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1353:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4033:Car9 UTSW 4 43,508,624 (GRCm39) missense possibly damaging 0.52
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R4719:Car9 UTSW 4 43,508,616 (GRCm39) nonsense probably null
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On 2014-02-11