Incidental Mutation 'R1352:Aldh4a1'
ID156696
Institutional Source Beutler Lab
Gene Symbol Aldh4a1
Ensembl Gene ENSMUSG00000028737
Gene Namealdehyde dehydrogenase 4 family, member A1
SynonymsP5CDH, Ssdh1, A930035F14Rik, ALDH4, Ahd1, Ahd-1
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R1352 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location139622866-139649690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139635519 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000043821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039818] [ENSMUST00000178644]
PDB Structure
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with sulfate ion [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with the product glutamate [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with NAD+ [X-RAY DIFFRACTION]
Crystal Structure of Mus musculus 1-pyrroline-5-carboxylate dehydrogenase cryoprotected in proline [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with acetate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glyoxylate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with malonate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with succinate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glutarate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000039818
AA Change: V142A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146309
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Aldh4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Aldh4a1 APN 4 139642160 nonsense probably null
IGL01916:Aldh4a1 APN 4 139644146 missense probably damaging 1.00
IGL02368:Aldh4a1 APN 4 139648200 nonsense probably null
IGL02469:Aldh4a1 APN 4 139648161 missense probably damaging 0.98
PIT4402001:Aldh4a1 UTSW 4 139642191 nonsense probably null
R0511:Aldh4a1 UTSW 4 139642571 splice site probably benign
R1484:Aldh4a1 UTSW 4 139643447 missense probably benign 0.00
R1717:Aldh4a1 UTSW 4 139638529 missense possibly damaging 0.93
R1717:Aldh4a1 UTSW 4 139633994 splice site probably null
R1729:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1784:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1785:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R1786:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R3696:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3697:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3698:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R4603:Aldh4a1 UTSW 4 139643429 missense probably damaging 0.97
R5197:Aldh4a1 UTSW 4 139648301 intron probably benign
R5375:Aldh4a1 UTSW 4 139633922 missense probably benign
R5539:Aldh4a1 UTSW 4 139638522 missense probably benign 0.05
R5590:Aldh4a1 UTSW 4 139642104 missense probably damaging 1.00
R6101:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
R6105:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTCACAATAACAGCAGGATGGGC -3'
(R):5'- GCAACTCTGTGGTTGTTTAAGAGCG -3'

Sequencing Primer
(F):5'- CTGTAGCAGTGTGGACAGGAC -3'
(R):5'- TGTTTAAGAGCGCCCACTGAG -3'
Posted On2014-02-11