Mutagenetix > Incidental Mutation

Incidental Mutation 'R1332:Lair1'

156738

Institutional Source

Beutler Lab

Gene Symbol

Lair1

Ensembl Gene

ENSMUSG00000055541

Gene Name

leukocyte-associated Ig-like receptor 1

Synonyms

5133400O11Rik, Lair-1, D7Bwg0421e, mLair-1

MMRRC Submission

039397-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4006401-4066203 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4013595 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 36 (E36G)

Ref Sequence

ENSEMBL: ENSMUSP00000145940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]

AlphaFold

Q8BG84

Predicted Effect

probably benign
Transcript: ENSMUST00000068865
AA Change: E75G

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541
AA Change: E75G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	33	55	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086400
AA Change: E185G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: E185G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	5e-79	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	9e-27	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086401
AA Change: E185G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: E185G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	1e-78	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	2e-26	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108600
AA Change: E146G

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: E146G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	133	8e-79	PDB
SCOP:d1nkr_2	24	118	1e-9	SMART
Blast:IG	38	119	6e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000131126

SMART Domains

Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136616

SMART Domains

Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000149395

SMART Domains

Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205296
AA Change: E36G

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206445

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 93.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933415A04Rik	T	TNNNNNNNNNNNNNNNNNN	11: 43,478,256 (GRCm39)		probably benign	Het
Abhd14b	A	T	9: 106,329,195 (GRCm39)	I42F	probably damaging	Het
Apbb1	A	T	7: 105,214,750 (GRCm39)	I498N	possibly damaging	Het
Asah2	A	G	19: 32,022,341 (GRCm39)	I231T	probably damaging	Het
Bid	C	T	6: 120,874,216 (GRCm39)	A110T	possibly damaging	Het
Caskin2	C	T	11: 115,694,171 (GRCm39)		probably benign	Het
Ccdc141	T	C	2: 76,844,784 (GRCm39)	T1428A	probably damaging	Het
Cd22	A	C	7: 30,569,912 (GRCm39)	W477G	possibly damaging	Het
Cox16	T	C	12: 81,519,064 (GRCm39)	D89G	probably damaging	Het
Dnah17	A	G	11: 117,934,041 (GRCm39)	I3511T	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,901 (GRCm39)	Y333N	probably damaging	Het
Eya2	T	C	2: 165,529,528 (GRCm39)		probably benign	Het
Fras1	A	G	5: 96,855,167 (GRCm39)	D1892G	probably benign	Het
Hlf	G	T	11: 90,231,679 (GRCm39)	S265*	probably null	Het
Immt	T	C	6: 71,823,256 (GRCm39)		probably benign	Het
Lrfn5	T	C	12: 61,904,314 (GRCm39)		probably benign	Het
Nos1ap	T	C	1: 170,177,001 (GRCm39)	N134S	probably damaging	Het
Ogfod1	T	C	8: 94,784,727 (GRCm39)	C344R	probably damaging	Het
Or6c212	A	G	10: 129,559,116 (GRCm39)	L99S	probably damaging	Het
Pkhd1l1	G	A	15: 44,368,943 (GRCm39)	V863I	probably damaging	Het
Pmfbp1	T	G	8: 110,256,898 (GRCm39)	I534S	probably damaging	Het
Prex2	A	G	1: 11,274,315 (GRCm39)	D1329G	probably damaging	Het
Rasal2	T	C	1: 157,003,391 (GRCm39)	T423A	probably benign	Het
Rif1	T	A	2: 51,968,326 (GRCm39)	W170R	probably benign	Het
Scarb2	C	T	5: 92,599,205 (GRCm39)		probably null	Het
Stard9	C	A	2: 120,504,117 (GRCm39)	S221R	probably damaging	Het
Tlr3	A	C	8: 45,851,774 (GRCm39)	N374K	probably damaging	Het
Uck1	T	C	2: 32,149,666 (GRCm39)	D71G	probably damaging	Het
Vcan	C	T	13: 89,841,174 (GRCm39)	E497K	probably damaging	Het
Vmn2r86	G	A	10: 130,282,739 (GRCm39)	L626F	probably damaging	Het
Vmn2r89	A	G	14: 51,692,559 (GRCm39)	T121A	probably benign	Het
Wdr64	T	C	1: 175,622,706 (GRCm39)	S828P	possibly damaging	Het
Zfp334	A	T	2: 165,222,776 (GRCm39)	H422Q	probably damaging	Het

Other mutations in Lair1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lair1	APN	7	4,031,730 (GRCm39)	missense	probably benign	0.01
IGL01475:Lair1	APN	7	4,012,683 (GRCm39)	utr 3 prime	probably benign
IGL02696:Lair1	APN	7	4,013,848 (GRCm39)	intron	probably benign
IGL02749:Lair1	APN	7	4,031,900 (GRCm39)	missense	possibly damaging	0.50
R0396:Lair1	UTSW	7	4,013,785 (GRCm39)	missense	probably damaging	1.00
R0703:Lair1	UTSW	7	4,013,759 (GRCm39)	missense	probably null	0.99
R1053:Lair1	UTSW	7	4,031,784 (GRCm39)	missense	probably damaging	1.00
R1717:Lair1	UTSW	7	4,013,788 (GRCm39)	missense	probably damaging	1.00
R2022:Lair1	UTSW	7	4,066,063 (GRCm39)	splice site	probably null
R2509:Lair1	UTSW	7	4,013,782 (GRCm39)	missense	probably damaging	1.00
R3721:Lair1	UTSW	7	4,013,782 (GRCm39)	missense	probably damaging	1.00
R4021:Lair1	UTSW	7	4,058,915 (GRCm39)	critical splice donor site	probably null
R4784:Lair1	UTSW	7	4,012,731 (GRCm39)	missense	probably benign	0.15
R4873:Lair1	UTSW	7	4,032,033 (GRCm39)	missense	probably benign	0.05
R4875:Lair1	UTSW	7	4,032,033 (GRCm39)	missense	probably benign	0.05
R4940:Lair1	UTSW	7	4,031,948 (GRCm39)	missense	probably benign	0.00
R5125:Lair1	UTSW	7	4,013,488 (GRCm39)	missense	possibly damaging	0.92
R5178:Lair1	UTSW	7	4,013,488 (GRCm39)	missense	possibly damaging	0.92
R5888:Lair1	UTSW	7	4,013,844 (GRCm39)	missense	probably damaging	0.96
R5965:Lair1	UTSW	7	4,032,023 (GRCm39)	missense	possibly damaging	0.46
R6119:Lair1	UTSW	7	4,031,895 (GRCm39)	missense	probably benign	0.43
R6265:Lair1	UTSW	7	4,058,826 (GRCm39)	intron	probably benign
R6305:Lair1	UTSW	7	4,013,727 (GRCm39)	critical splice donor site	probably null
R6915:Lair1	UTSW	7	4,058,952 (GRCm39)	missense	possibly damaging	0.89
R7964:Lair1	UTSW	7	4,013,803 (GRCm39)	missense	probably benign	0.22
R7991:Lair1	UTSW	7	4,031,969 (GRCm39)	missense	probably damaging	1.00
R9414:Lair1	UTSW	7	4,013,819 (GRCm39)	missense	probably benign	0.09
R9787:Lair1	UTSW	7	4,013,794 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGAAGCCTGTCATCTGCAAC -3'
(R):5'- GGCCAACACTTATGACCAGTGACAC -3'

Sequencing Primer
(F):5'- TTGGTTCCCAATATACTGGATAACCC -3'
(R):5'- ataaatgtatgctgaTGATAACCTGG -3'

Posted On

2014-02-11