Incidental Mutation 'R1332:Or6c212'
ID 156745
Institutional Source Beutler Lab
Gene Symbol Or6c212
Ensembl Gene ENSMUSG00000096858
Gene Name olfactory receptor family 6 subfamily C member 212
Synonyms Olfr805, GA_x6K02T2PULF-11402237-11401278, MOR110-4
MMRRC Submission 039397-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1332 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 129558452-129559411 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129559116 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 99 (L99S)
Ref Sequence ENSEMBL: ENSMUSP00000149493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078876] [ENSMUST00000204717] [ENSMUST00000216794] [ENSMUST00000217219]
AlphaFold Q8VFI4
Predicted Effect probably damaging
Transcript: ENSMUST00000078876
AA Change: L99S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092874
Gene: ENSMUSG00000096858
AA Change: L99S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.9e-52 PFAM
Pfam:7tm_1 39 288 5.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203573
AA Change: L99S
SMART Domains Protein: ENSMUSP00000144843
Gene: ENSMUSG00000096858
AA Change: L99S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.9e-52 PFAM
Pfam:7tm_1 39 288 5.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204717
Predicted Effect probably damaging
Transcript: ENSMUST00000216794
AA Change: L99S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217219
AA Change: L99S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik T TNNNNNNNNNNNNNNNNNN 11: 43,478,256 (GRCm39) probably benign Het
Abhd14b A T 9: 106,329,195 (GRCm39) I42F probably damaging Het
Apbb1 A T 7: 105,214,750 (GRCm39) I498N possibly damaging Het
Asah2 A G 19: 32,022,341 (GRCm39) I231T probably damaging Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Caskin2 C T 11: 115,694,171 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,844,784 (GRCm39) T1428A probably damaging Het
Cd22 A C 7: 30,569,912 (GRCm39) W477G possibly damaging Het
Cox16 T C 12: 81,519,064 (GRCm39) D89G probably damaging Het
Dnah17 A G 11: 117,934,041 (GRCm39) I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 (GRCm39) Y333N probably damaging Het
Eya2 T C 2: 165,529,528 (GRCm39) probably benign Het
Fras1 A G 5: 96,855,167 (GRCm39) D1892G probably benign Het
Hlf G T 11: 90,231,679 (GRCm39) S265* probably null Het
Immt T C 6: 71,823,256 (GRCm39) probably benign Het
Lair1 T C 7: 4,013,595 (GRCm39) E36G possibly damaging Het
Lrfn5 T C 12: 61,904,314 (GRCm39) probably benign Het
Nos1ap T C 1: 170,177,001 (GRCm39) N134S probably damaging Het
Ogfod1 T C 8: 94,784,727 (GRCm39) C344R probably damaging Het
Pkhd1l1 G A 15: 44,368,943 (GRCm39) V863I probably damaging Het
Pmfbp1 T G 8: 110,256,898 (GRCm39) I534S probably damaging Het
Prex2 A G 1: 11,274,315 (GRCm39) D1329G probably damaging Het
Rasal2 T C 1: 157,003,391 (GRCm39) T423A probably benign Het
Rif1 T A 2: 51,968,326 (GRCm39) W170R probably benign Het
Scarb2 C T 5: 92,599,205 (GRCm39) probably null Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Tlr3 A C 8: 45,851,774 (GRCm39) N374K probably damaging Het
Uck1 T C 2: 32,149,666 (GRCm39) D71G probably damaging Het
Vcan C T 13: 89,841,174 (GRCm39) E497K probably damaging Het
Vmn2r86 G A 10: 130,282,739 (GRCm39) L626F probably damaging Het
Vmn2r89 A G 14: 51,692,559 (GRCm39) T121A probably benign Het
Wdr64 T C 1: 175,622,706 (GRCm39) S828P possibly damaging Het
Zfp334 A T 2: 165,222,776 (GRCm39) H422Q probably damaging Het
Other mutations in Or6c212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Or6c212 APN 10 129,558,814 (GRCm39) missense probably benign
IGL01341:Or6c212 APN 10 129,558,747 (GRCm39) missense possibly damaging 0.87
IGL01960:Or6c212 APN 10 129,558,756 (GRCm39) missense probably damaging 1.00
IGL02729:Or6c212 APN 10 129,559,390 (GRCm39) missense probably benign 0.01
IGL02969:Or6c212 APN 10 129,559,065 (GRCm39) missense probably damaging 0.99
R0116:Or6c212 UTSW 10 129,558,846 (GRCm39) missense probably damaging 1.00
R1236:Or6c212 UTSW 10 129,558,675 (GRCm39) missense probably damaging 0.98
R2428:Or6c212 UTSW 10 129,558,652 (GRCm39) missense probably benign 0.05
R3725:Or6c212 UTSW 10 129,558,984 (GRCm39) missense probably damaging 1.00
R3726:Or6c212 UTSW 10 129,558,984 (GRCm39) missense probably damaging 1.00
R3804:Or6c212 UTSW 10 129,558,918 (GRCm39) missense possibly damaging 0.93
R4365:Or6c212 UTSW 10 129,559,281 (GRCm39) missense probably damaging 0.99
R4630:Or6c212 UTSW 10 129,559,350 (GRCm39) missense probably damaging 1.00
R4735:Or6c212 UTSW 10 129,558,792 (GRCm39) missense probably benign 0.06
R4923:Or6c212 UTSW 10 129,558,681 (GRCm39) missense probably benign 0.03
R4962:Or6c212 UTSW 10 129,558,592 (GRCm39) missense probably damaging 1.00
R5324:Or6c212 UTSW 10 129,558,814 (GRCm39) missense probably benign
R5406:Or6c212 UTSW 10 129,558,799 (GRCm39) missense probably damaging 1.00
R7705:Or6c212 UTSW 10 129,559,018 (GRCm39) missense probably benign 0.01
R8464:Or6c212 UTSW 10 129,558,783 (GRCm39) missense possibly damaging 0.88
R9368:Or6c212 UTSW 10 129,558,881 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAGTGTCTGTGCAAGACAGC -3'
(R):5'- GGATCTTCGCCTCAAGACTCCAATG -3'

Sequencing Primer
(F):5'- GCACAGAAATCCAGTTTGAGTC -3'
(R):5'- GCCTCAAGACTCCAATGTACTTC -3'
Posted On 2014-02-11