Incidental Mutation 'R1332:4933415A04Rik'
List |< first << previous [record 12 of 686] next >> last >|
ID156747
Institutional Source Beutler Lab
Gene Symbol 4933415A04Rik
Ensembl Gene ENSMUSG00000045877
Gene NameRIKEN cDNA 4933415A04 gene
Synonyms
MMRRC Submission 039397-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1332 (G1)
Quality Score155
Status Not validated
Chromosome11
Chromosomal Location43587040-43589048 bp(+) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) T to TNNNNNNNNNNNNNNNNNN at 43587429 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050574] [ENSMUST00000056256]
Predicted Effect probably benign
Transcript: ENSMUST00000050574
SMART Domains Protein: ENSMUSP00000058111
Gene: ENSMUSG00000044707

DomainStartEndE-ValueType
CYCLIN 43 135 7.96e-14 SMART
Cyclin_C 144 281 2.52e-22 SMART
CYCLIN 153 247 1.58e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056256
SMART Domains Protein: ENSMUSP00000062657
Gene: ENSMUSG00000045877

DomainStartEndE-ValueType
transmembrane domain 30 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A T 9: 106,451,996 I42F probably damaging Het
Apbb1 A T 7: 105,565,543 I498N possibly damaging Het
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Caskin2 C T 11: 115,803,345 probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Cd22 A C 7: 30,870,487 W477G possibly damaging Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Eya2 T C 2: 165,687,608 probably benign Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Hlf G T 11: 90,340,853 S265* probably null Het
Immt T C 6: 71,846,272 probably benign Het
Lair1 T C 7: 4,010,596 E36G possibly damaging Het
Lrfn5 T C 12: 61,857,528 probably benign Het
Nos1ap T C 1: 170,349,432 N134S probably damaging Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Olfr805 A G 10: 129,723,247 L99S probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Prex2 A G 1: 11,204,091 D1329G probably damaging Het
Rasal2 T C 1: 157,175,821 T423A probably benign Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Scarb2 C T 5: 92,451,346 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tlr3 A C 8: 45,398,737 N374K probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Vmn2r86 G A 10: 130,446,870 L626F probably damaging Het
Vmn2r89 A G 14: 51,455,102 T121A probably benign Het
Wdr64 T C 1: 175,795,140 S828P possibly damaging Het
Zfp334 A T 2: 165,380,856 H422Q probably damaging Het
Other mutations in 4933415A04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0106:4933415A04Rik UTSW 11 43587373 unclassified probably benign
R0541:4933415A04Rik UTSW 11 43587400 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGATAGGGCTTTTCTGAGCAGATGG -3'
(R):5'- GGCTGACTTGCTAAGAGATGTCCAG -3'

Sequencing Primer
(F):5'- CAGATGGATGTCTCATGGAAAC -3'
(R):5'- GGACATCTGGTCCTGAGAATC -3'
Posted On2014-02-11