Incidental Mutation 'R1332:Vmn2r89'
ID156754
Institutional Source Beutler Lab
Gene Symbol Vmn2r89
Ensembl Gene ENSMUSG00000070448
Gene Namevomeronasal 2, receptor 89
SynonymsV2r10, V2r11
MMRRC Submission 039397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1332 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51451962-51461293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51455102 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 121 (T121A)
Ref Sequence ENSEMBL: ENSMUSP00000124256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159611] [ENSMUST00000159734] [ENSMUST00000161670] [ENSMUST00000162998]
Predicted Effect probably benign
Transcript: ENSMUST00000159611
AA Change: T121A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124065
Gene: ENSMUSG00000070448
AA Change: T121A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 449 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159734
AA Change: T121A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124256
Gene: ENSMUSG00000070448
AA Change: T121A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 420 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161670
SMART Domains Protein: ENSMUSP00000124261
Gene: ENSMUSG00000070448

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Meta Mutation Damage Score 0.1668 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik T TNNNNNNNNNNNNNNNNNN 11: 43,587,429 probably benign Het
Abhd14b A T 9: 106,451,996 I42F probably damaging Het
Apbb1 A T 7: 105,565,543 I498N possibly damaging Het
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Caskin2 C T 11: 115,803,345 probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Cd22 A C 7: 30,870,487 W477G possibly damaging Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Eya2 T C 2: 165,687,608 probably benign Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Hlf G T 11: 90,340,853 S265* probably null Het
Immt T C 6: 71,846,272 probably benign Het
Lair1 T C 7: 4,010,596 E36G possibly damaging Het
Lrfn5 T C 12: 61,857,528 probably benign Het
Nos1ap T C 1: 170,349,432 N134S probably damaging Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Olfr805 A G 10: 129,723,247 L99S probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Prex2 A G 1: 11,204,091 D1329G probably damaging Het
Rasal2 T C 1: 157,175,821 T423A probably benign Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Scarb2 C T 5: 92,451,346 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tlr3 A C 8: 45,398,737 N374K probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Vmn2r86 G A 10: 130,446,870 L626F probably damaging Het
Wdr64 T C 1: 175,795,140 S828P possibly damaging Het
Zfp334 A T 2: 165,380,856 H422Q probably damaging Het
Other mutations in Vmn2r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Vmn2r89 APN 14 51454965 missense probably damaging 1.00
IGL00990:Vmn2r89 APN 14 51455971 missense probably benign 0.14
IGL00990:Vmn2r89 APN 14 51457493 missense probably benign
IGL01991:Vmn2r89 APN 14 51452219 missense probably benign 0.00
IGL03073:Vmn2r89 APN 14 51456071 missense possibly damaging 0.95
IGL03085:Vmn2r89 APN 14 51452158 missense probably damaging 0.99
IGL03278:Vmn2r89 APN 14 51455100 missense probably damaging 0.99
R0115:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0127:Vmn2r89 UTSW 14 51455703 missense probably damaging 0.98
R0391:Vmn2r89 UTSW 14 51455978 missense probably damaging 0.99
R0481:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0538:Vmn2r89 UTSW 14 51457591 splice site probably null
R1210:Vmn2r89 UTSW 14 51454970 missense probably benign 0.01
R1660:Vmn2r89 UTSW 14 51456236 missense possibly damaging 0.48
R1959:Vmn2r89 UTSW 14 51457440 missense probably benign 0.22
R2876:Vmn2r89 UTSW 14 51455084 missense possibly damaging 0.47
R3410:Vmn2r89 UTSW 14 51456171 missense probably damaging 0.98
R4026:Vmn2r89 UTSW 14 51452043 start codon destroyed probably null 1.00
R4398:Vmn2r89 UTSW 14 51452094 missense probably damaging 1.00
R4700:Vmn2r89 UTSW 14 51457485 missense probably damaging 1.00
R4714:Vmn2r89 UTSW 14 51452231 missense probably damaging 0.97
R5162:Vmn2r89 UTSW 14 51456163 missense possibly damaging 0.88
R5294:Vmn2r89 UTSW 14 51455113 missense probably benign 0.00
R5811:Vmn2r89 UTSW 14 51456108 missense probably benign 0.12
R6087:Vmn2r89 UTSW 14 51457576 synonymous probably null
R6229:Vmn2r89 UTSW 14 51455721 missense probably benign 0.05
R6246:Vmn2r89 UTSW 14 51456046 missense probably damaging 1.00
R6572:Vmn2r89 UTSW 14 51455993 missense probably damaging 1.00
X0019:Vmn2r89 UTSW 14 51456415 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCGGGTGTTATCTAAGAAGGGCTGTT -3'
(R):5'- CCCATTCAGTGTCACATGTTCTTACCA -3'

Sequencing Primer
(F):5'- GAACTGTAATCTAGTTCAAGGATGGC -3'
(R):5'- CCATTGGTATTGAAGAATCCATTGC -3'
Posted On2014-02-11